Changes in ceramide metabolism are essential in Madin-Darby canine kidney cell differentiation

• DOI: 10.1194/jlr.m076349
• Publication Date: 2017-05-18T01:00:25Z
• Authors: Lucila Gisele Pescio; Bruno Jaime Santa...; Vanina Gisela Lopez; Carlos Humberto P...; Daniela Judith Ro...; Nicolás Octavio F...; Norma Beatriz Ste...
• Keywords: Sphingolipid; Lactosylceramide; Ceramide synthase

Ceramides (Cers) and complex sphingolipids with defined acyl chain lengths play important roles in numerous cell processes. Six Cer synthase (CerS) isoenzymes (CerS1–6) are the key enzymes responsible for production of diversity molecular species. In this study, we investigated changes sphingolipid metabolism during differentiation Madin-Darby canine kidney (MDCK) cells. By MALDI TOF MS, analyzed species Cer, glucosylceramide (GlcCer), lactosylceramide (LacCer), SM nondifferentiated differentiated cells (cultured under hypertonicity). The detected were same, but subjected to hypertonicity presented higher levels C24:1 GlcCer, SM, C16:0 LacCer. Consistently species, MDCK expressed CerS2, CerS4, CerS6, no differences differentiation. We next evaluated different synthesis pathways inhibitors found that presence amitriptyline, an inhibitor acid sphingomyelinase, showed decreased radiolabeled incorporation LacCer did not develop a mature apical membrane. These results suggest induces endolysosomal degradation generating used as substrate specific glycosphingolipids essential Sphingolipids large diverse class lipids possess bioactive properties control myriad cellular physiological programs (1Hannun Y.A. Obeid L.M. Principles lipid signalling: lessons from sphingolipids.Nat. Rev. Mol. Cell Biol. 2008; 9: 139-150Crossref PubMed Scopus (2440) Google Scholar). Ceramide (Cer) is precursor sphingolipids, such (GSLs) considered intracellular signaling molecule involved regulating differentiation, proliferation, apoptosis (2Pettus B.J. Chalfant C.E. Hannun apoptosis: overview current perspectives.Biochim. Biophys. Acta. 2002; 1585: 114-125Crossref (670) Scholar, 3Kolesnick R. therapeutic potential modulating ceramide/sphingomyelin pathway.J. Clin. Invest. 110: 3-8Crossref (381) synthesized de novo endoplasmic reticulum by series reactions begin condensation L-serine palmitoyl-CoA serine palmitoyl transferase (4Hanada K. Serine palmitoyltransferase, enzyme metabolism.Biochim. 2003; 1632: 16-30Crossref (453) resulting product, 3-ketosphinganine, then reduced form dihydrosphingosine 3-ketosphinganine reductase. Dihydrosphingosine further acylated (dihydro)Cer synthases (CerSs) dihydroceramide, subsequent reduction dihydroceramide desaturase (5Futerman A.H. Riezman H. ins outs synthesis.Trends 2005; 15: 312-318Abstract Full Text PDF (259) also produced recycled sphingosine formed breakdown (salvage pathway). Therefore, CerSs both salvage pathway sphingolipids. mammals, six CerS isoforms (CerS1–6), which display type- or tissue-specific expression pattern, have been identified (6Laviad E.L. Albee L. Pankova-Kholmyansky I. Epstein S. Park Merrill Futerman Characterization ceramide 2.J. Chem. 283: 5677-5684Abstract (362) Each has preference unique range acyl-CoAs particular length. CerS1 uses C18-CoA; CerS2 C22- C26-CoA; CerS3 exhibits broad specificity (C18- C24-CoA); CerS4 appears C18-CoA C20-CoA; CerS5 CerS6 use C14-CoA C16-CoA 7Venkataraman Riebeling C. Bodennec J. Allegood J.C. Sullards M.C. Upstream growth factor 1 (uog1), mammalian homolog yeast longevity assurance gene (LAG1), regulates N-stearoyl-sphinganine (C18-(dihydro)ceramide) fumonisin B1-independent manner cells.J. 277: 35642-35649Abstract (234) 8Guillas Jiang Vionnet Roubaty Uldry D. Chuard Wang Jazwinski S.M. Conzelmann A. Human homologues LAG1 reconstitute acyl-CoA-dependent yeast.J. 278: 37083-37091Abstract (85) 9Riebeling E. Two (LAG1) family members, trh1 trh4, regulate using fatty acyl-CoA donors.J. 43452-43459Abstract (246) 10Mizutani Y. Kihara Igarashi Mammalian Lass6 its related members ceramides.Biochem. 390: 263-271Crossref (303) 11Mizutani LASS3 (longevity homologue 3) mainly testis-specific (dihydro)ceramide relatively specificity.Biochem. 2006; 398: 531-538Crossref (138) specificities individual contribute chain-length (12Pewzner-Jung Ben-Dor When do Lasses genes) become (ceramide synthases)?.J. 281: 25001-25005Abstract It now recognized biological functions it only subset Cers certain This may be location, enzymes, length, and/or biosynthetic (13Mullen T.D. at centre biology.Biochem. 2012; 441: 789-802Crossref (341) previously demonstrated induced hypertonicity, program includes increase GSL (14Pescio L.G. Favale N.O. Marquez M.G. Sterin-Speziale N.B. Glycosphingolipid differentiation.Biochim. 1821: 884-894Crossref (22) 15Favale Santacreu Pescio Sphingomyelin environmental hypertonicity.J. Lipid Res. 2015; 56: 786-800Abstract (12) increased GSLs acquire cell-differentiated phenotype, reflected development membrane domain formation primary cilium, last steps final epithelial observed induction evoked B1 (FB1)-resistant served pool previous observations led us wonder about possibility could associated address GSLs. Consequently, aim present work was investigate profile displayed achieve optimal combination American Type Culture Collection (2 × 105 per 35 mm dish) grown DMEM/F-12 (Invitrogen) supplemented 10% FBS, penicillin (100 μg/ml), streptomycin μg/ml) 37°C humidified 5% CO2 atmosphere. After 24 h, medium replaced containing 0.5% FBS incubated another h reach confluence. Then, kept isotonicity switched hypertonic (300 mM NaCl) 48 absence FB1 (20 μM) (Sigma). treatments, trypsinized counted trypan blue exclusion procedure. without antibiotics h. cultured transfected 25 nM double-stranded siRNAs sphingomyelinase (aSMase) scrambled sequence HiPerFect transfection reagent (Qiagen) according manufacturer's instructions. reagents washed out 1% 300 NaCl sequences aSMase 5′ UGGAAUUAUUACCGGAUUGUAdTdT 3′ (sense) UACAAUCCGGUAAUAAUUCCAdTdT (antisense) siRNA CAGUCGCGUUUGCGACUGG CCAGUCGCAAACGCGACUG (antisense). PBS transferred into 13 100 borosilicate tubes Teflon-lined caps. adding 0.5 ml methanol 0.25 chloroform, sonicated bath- type sonicator until they appeared dispersed. single phase mixture 48°C overnight heating block. cooling, 75 μl M KOH added 2 cleave potentially interfering glycerolipids. cooling room temperature, approximately 6 glacial acetic bring pH near neutral. chloroform water centrifuged separate phases. lower extracted solvent evaporated N2 atmosphere (16Merrill Jr., Kelly Sphingolipidomics: high-throughput, structure-specific, quantitative analysis liquid chromatography tandem mass spectrometry.Methods. 36: 207-224Crossref (463) MS positive ion spectra normally dominated because sensitivity molecules quaternary ammonia groups. To overcome problem able detect all separation total extract subclasses unequivocally necessary (17Schiller Süß Arnhold Fuchs B. Leßig Müller M. Petković Spalteholz Zschörnig O. Arnold Matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) spectrometry phospholipid research.Prog. 2004; 43: 449-488Crossref (294) Because that, separated TLC. Aliquots extracts dissolved spotted onto TLC plate (Merck) developed two systems: first butanol:acetic acid:water (60:20:20, v/v/v; 1), cut above band corresponding standard, top portion run (chloroform:methanol, 50:1.5, v/v). For analysis, chloroform:methanol:acetic (40:10:10:1, v/v/v/v). plates revealed primuline staining visualized UV light (18van Echten-Deckert G. Sphingolipid extraction thin-layer chromatography.Methods Enzymol. 2000; 312: 64-79Crossref bands scraped off mobility standards silica extraction. performed three successive extractions chloroform:methanol:water (5:5:1 volume), thoroughly mixing, centrifuging, collecting solvents, partitioning 4 vol recover (19Oresti G.M. Reyes J.G. Luquez J.M. Osses N. Furland N.E. Aveldaño M.I. Differentiation-related classes long-chain very polyenoic acids rat spermatogenic 2010; 51: 2909-2921Abstract (42) flow samples prepared analysis. C12:0 (d18:1/12:0; N-lauroyl-D-erythro-sphingosylphosphorylcholine), N-lauroyl-D-erythrosphingosine), C18:0 GlcCer (d18:1/18:0; D-glucosyl-β-1,1′ N-stearoyl-D-erythro-sphingosine), D-lactosyl-β-1,1′ N-laurosyl-D-erythro-sphingosine), Avanti Polar Lipids, DL-dihydrosphingosine Sigma. sample obtained procedure cleaned micro-adsorptive C18 pipette ZipTips (Millipore) microliters each eluated mixed matrix solution [20 mg/ml 2,5-dihydroxybenzoic (Sigma) methanol:TFA (90:0.1, v/v) (NH4)2SO4]. directly air-dried. All spectrometric analyses LANAIS-PROEM-CONICET-Argentina 4800 TOF/TOF™ analyzer (Applied Biosystems) equipped ND:YAG (355 nm) mode. data acquired Data Explorer software. Conditions were: acceleration voltage: grid source 1, 0.8050; mirror 1.4611; 1.0900. Source 20 kV; delayed time 330 nanoseconds; typical parts million error 50–80 ppm. labeled feeding D-[1-14C]galactose μCi/ml; Radiolabeled Chemicals) 5 before trypsinization extraction, described above. short-term incubation, [amitriptyline (30 μM), amitriptyline addition L-cycloserine (CS) (0.5 mM), μM)] [14C]galactose (total incubation: h), long-term incubation 49 h). Extracted plate, chloroform:methanol:0.22% CaCl2 (60:35:8, v/v/v) autoradiography. radioactive spots additional measurement scintillation counting. normalized number counts incorporated every 106 Total RNA SV isolation system (Promega) accordance Equal amounts (500 ng) synthesize first-strand cDNA reverse transcriptase PCR. Primers PCR TCAGTGCAATTGGTGGAAAA (forward) ACCTTGAGCGGAAACCAGTA (reverse) CerS1, CCCACCTTGGAGCATTTCTA TCGGGTGATGATGAAGACAA GATT­TTGGCTTCCTCCAACA GGGGTAGCCATTCCATACCT CerS3, TCCTACAGCTCCAACCTGCT CTGGGCAATGGAGTCGTAGT GTTCTG­GGACATCCGACAGT TGAGCTGCTTTCCACATCAC CerS5, TAGCCAAACCATGTGCCATA TGCCTTGTATTCCACAACCA ACCACAGTCCATGCCATCAC (forward), ATGTCGTTGTC­CCA­CCACCT GAPDH. RT-PCR products resolved on 2% agarose gels. Relative real-time Rotor-Gene Q cDNA, new set primers, Real-Mix (Biodynamics) CGTCTTTGCCATTGTCTTCA CAGCTGTAGCACTCCCATCA CTGAAACCGGCCCTGTACTA GCAGGTTGGAGCTGTAGGAG GCCCTCAATGACCACTTTGT CTCCTTGGAGGCCATGTAGA coverslips cultured, above, CS μM). subjection hypertonicity. treatment, fixed 4% paraformaldehyde min permeabilized 0.1% (v/v) Triton X-100 min. blocking, 90 1:10 mouse anti-gp135 (kindly donated Dr. Ojakian) 1:2,000 rabbit anti-α catenin temperature. Primary interactions anti-rabbit FITC anti-mouse TRITC-conjugated antibodies (Jackson Immunoresearch). 60 min, mounted microscope glass slides Vectashield mounting (Vector Laboratory). Images Olympus FV300 confocal (model BX61) Ar He-Ne lasers, oil immersion 60× objective numerical aperture 1.4. taken acquisition software, FluoView version 3.3, Image-Pro plus 4.5, image LacCer, process. determinations achieved MS. (control) trypsinized, extracted, et al. Scholar), If v:v:v) system, migrated front run, thus making difficult distinguish interferences. difficulty, one-dimensional two-step TLC, Materials Methods. Figure shows representative second step development. comparison bottom portion, while portion. gel identity confirmed MS/MS. Characteristic fragmentation patterns (m/z 264, − 2H2O; m/z 282, H2O), {m/z 264; 282; [M+H]+ glucose; (glucose + H2O)}, (LacCer H2O)}. 2A isolated Peaks 550.6 522.6 corresponded dimethyldioctadecylammonium respectively, common contaminants (20Manier M.L. Cornett D.S. Hachey D.L. Caprioli R.M. Identification 550.6) 522.6, 494.6) contamination spectrometry.J. Am. Soc. Mass Spectrom. 19: 666-670Crossref [M+H H2O]+ [M+Na]+ adducts. [M+K]+ adducts almost eliminated ZipTips. spectrum enlarged 510–690, 680–850, 840–1,010, visualize [M+H]+, H2O]+, ions subspecies (supplemental Fig. S1). main listed Table detected, left part column predicted monoisotopic mass. d18:1 provided MS/MS analyses, detection fragments 264 (sphingosine 2H2O). major Cer: d18:1/C16:0, d18:1/C18:0, d18:1/C20:0, d18:1/C22:0, d18:1/C24:1, d18:1/C24:0. show same backbone free Cers. Note some observed. evidence reports matrix, neutral oligosaccharides render preferentially sodiated ions, (21Tanaka Yamada Tamiya-Koizumi Kannagi Aoyama T. Hara Kyogashima Systematic comprising MALDI-TOF high-energy CID.Glycoconj. 2011; 28: 67-87Crossref (16) 22Stahl Steup Karas Hillenkamp F. Analysis matrix-assisted spectrometry.Anal. 1991; 63: 1463-1466Crossref (354) Scholar).TABLE 1The values (monoisotopic) MSM+H H2OM+HM+NaExact MassDetectedExact MassDetectedd18:1/C16:0 Cer520.50935520.61538.51992538.62560.50189560.61d18:1/C18:0 Cer548.54065548.67566.55122566.73588.53319588.60d18:1/C20:0 Cer576.57190576.69594.58252594.69616.56449616.69d18:1/C22:0 Cer604.60325604.72622.61382622.73644.59579644.72d18:1/C24:1 Cer630.61890630.74648.62947648.75670.61144670.74d18:1/C24:0 Cer632.63455632.76650.64512650.76672.62709672.75d18:1/C16:0 GlcCer682.56218682.76700.57274700.76722.55472722.77d18:1/C18:0 GlcCer710.59348710.80728.60404728.86750.58602750.80d18:1/C20:0 GlcCer738.62478738.82756.63534756.71778.61732778.85d18:1/C22:0 GlcCer766.65608766.88784.66664784.84806.64862806.90d18:1/C24:1 GlcCer792.67173792.90810.68229810.92832.66427832.92d18:1/C24:0 GlcCer794.68738794.92812.69794812.92834.67992834.94d18:1/C16:0 LacCer844.6150844.71862.62557862.73884.60754884.72d18:1/C18:0 LacCer872.6463872.76866.65687912.63884912.75d18:1/C20:0 LacCer900.6776900.75918.68817940.67014940.79d18:1/C22:0 LacCer928.7089928.81946.71947946.84968.70144968.82d18:1/C24:1 LacCer954.7246954.84972.71512972.84994.71709994.84d18:1/C24:0 LacCer956.7402956.85974.75077974.85996.73274996.86 Open table tab relative composition (undifferentiated) (differentiated) shown 3. calculated based peak heights spectra. While represented 520.61, 630.74, 632.76), 722.77, 832.92, 834.94), 884.72, 994.84, 996.86) (Fig. 2, supplemental Moreover, prominent peaks dehydrated 2A), probably generated insource fragmentation. reason mentioned calculate percentage subspecies, height adducts, (for species). conditions analyzed, profiles differences. C24:0 predominant However, proportion Over increased, decreased; whereas over increased. Cells progressive percentages change enrichment C24 seemed occur expense slight decrease C22:0 GlcCer. low either experimental condition, after 3). return work, besides levels, amount favoring C24:1, C18:0, modified progression recent (15Favale interested analyzing undifferentiated A 4A. easily identified, shorter background peaks. ions. most abundant 703.7 accounted 76% [Fig. 4A(a)]. 650–850 better visualization 4A(b)]. Fragmentation mode 184, characteristic phosphocholine polar head, confirming identity. 4A(c). 4B Although hy