Phylogenetic study of mangrove associate grass Myriostachya wightiana (Nees ex Steud.) Hook. f. using rbcL gene sequence

• DOI: 10.14719/pst.2021.8.3.1133
• Publication Date: 2021-07-02T06:39:31Z
• Authors: K M Kiran; B V Sandeep
• Keywords: Maximum parsimony

Myriostachya is a monotypic genus in the family Poaceae, with only known species wightiana (Nees ex Steud.) Hook.f. It mangrove associate grass primarily distributed along muddy streams and channels intertidal swamps of India, Bangladesh, Sri Lanka, Myanmar, Thailand Sumatra. Molecular identification evolutionary studies M. unreported till now. Therefore, this study, phylogenetic analysis was established related members by using chloroplast rbcL gene-based systematics. The molecular phylogeny accomplished DNA extraction, PCR amplification sequencing gene analysis. genomic extract CTAB method F-5IATGTCACCACAAACAGAAACTAAAGC3I R-5ICTTCGGCACAAAATAAGAAACGATCTC3I primers. Phylogenetic performed multiple sequence alignment UPGMA, Maximum-parsimony tree constructed MEGAX. shows highest similarity to Paspalum species, has close branch vaginatum. divergence from maximum (0.49) Sorghum propinquum minimum (0.01) Oryza officinalis punctata. This study concluded that strong morphological relationship salt-tolerant sp.