A5086237005- Sugarcane Cultivation and Processing
- Biofuel production and bioconversion
- Agroforestry and silvopastoral systems
- Race, History, and American Society
- Forest ecology and management
- American Constitutional Law and Politics
- Bioenergy crop production and management
- Natural Products and Biological Research
- American Political and Social Dynamics
- Seedling growth and survival studies
- Plant Pathogenic Bacteria Studies
- Turfgrass Adaptation and Management
- Plant and fungal interactions
- Rice Cultivation and Yield Improvement
- Forest Biomass Utilization and Management
- Plant Disease Resistance and Genetics
- Ruminant Nutrition and Digestive Physiology
- Horticultural and Viticultural Research
- Genetics and Plant Breeding
- Vietnamese History and Culture Studies
- Tree Root and Stability Studies
- Plant Water Relations and Carbon Dynamics
- Crop Yield and Soil Fertility
- American History and Culture
- Communism, Protests, Social Movements
Yunnan Academy of Agricultural Sciences
2019-2023
Dale Bumpers Small Farms Research Center
2009-2020
Agricultural Research Service
2006-2017
United States Department of Agriculture
1991-2013
State University of New York
1972-2001
University of California, Berkeley
2001
UNSW Sydney
2001
Southern Regional Research Center
1998-1999
University of Kentucky
1988
Stony Brook University
1981
Abstract The global population is expected to increase by approximately 3 billion people 2050. With this in population, industry, transportation the cost of fossil fuels will grow dramatically. New technologies are needed for fuel extraction using feedstocks that do not threaten food security, cause minimal or no loss natural habitat and soil carbon. At same time, waste management has be improved environmental pollution should minimized eliminated. Liquid biofuels such as...
New insights into the public life and service of Herbert Hoover that sharply challenge accepted myths are provided in David Burner's biography much maligned thirty-first president.The persistence these can be largely attributed to intellectual biases, mistaken assumption was an arch conservative, fact Hoover's personal papers were not available for research prior 1963.During last decade a new generation historians, including Joan Hoff Wilson, Ellis Hawley, William Appleman Williams, have...
Abstract Globally, one of the major technologic goals is to achieve cost‐effective lignocellulosic ethanol production from biomass feedstocks. Lignocellulosic four dedicated energy crops [giant reed ( Arundo donax L.), elephantgrass Pennisetum purpureum (Schumach), Miscanthus × giganteus (Illinois clone), and (clone Q42641) {hybrid sinensis Anderss. sacchariflorus (Maxim)}, Hack. called giant miscanthus, sugarcane clone US 84‐1028 Saccharum L. spp. hybrid)] residues two [soybean Glycine max...
Sugarcane ( Saccharum L. spp. hybrids) propagated in vitro from shoot tips is generally assumed to be less phenotypically variable than callus culture. The objectives of this research were study stalk, milling, and morphological variant characteristics plants ‘CP 74‐383’ culture, direct regeneration, tip conventional bud propagation, assess the phenotypic stability after vegetative propagation. Plants evaluated plant‐cane first‐ratoon crops (Experiment 1). with normal or off‐type phenotypes...
A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from intergenic transcribed spacer (ITS) region 16S-23S ribosomal DNA C. and cynodontis were cloned sequenced. Based on a multiple sequence alignment among these two sequences other nonredundant highly homologous database, xyli-specific primers designed, Cxx1 (5′ CCGAAGTGAGCAGATTGACC) Cxx2...
The trehalose-6-phosphate synthase (TPS) gene family plays important roles in conferring plant stress resistance, but a comprehensive analysis of the is lacking for sugarcane (Saccharum spp. hybrids). objective this study to document functional classification, evolutionary characterization, and expression profiling TPS (ScTPS) family. Nine putative ScTPS genes were identified assigned two distinct classes based on structure phylogeny. Phylogenetic showed that 31 from Arabidopsis, rice could...
The design of agroforestry systems requires a thorough understanding biological interactions that might complement or constrain production. objective this study was to examine effects alley crop environment on persistence, herbage yield, nutritive value, and gas exchange (CO 2 rate, transpiration, stomatal conductance) two shade‐tolerant grasses. experiment conducted for 3 yr in orchardgrass ( Dactylis glomerata L.), tall fescue Festuca arundinacea Schreb.), 1:1 binary mixture (tall...
A polymerase chain reaction (PCR) protocol was developed that amplified a 360-bp DNA product unique to Xanthomonas albilineans (Xa), the causal agent of sugarcane leaf scald disease. The assay utilizes previously described PCR primers target intergenic transcribed spacer (ITS) region between 16S and 23S rRNA genes. Primer pair Ala4/L1 allowed amplification fragment from 71 Xa strains including representatives serovars I, II, III. Fragments different sizes were also three unidentified...
This is the story of rise to national power a desperately poor young man from Texas Hill Country. Revealed in extraordinary detail genesis that almost superhuman drive, energy and ambition which set LBJ apart. An acclaimed biography it charts his boyhood through years Depression debut as Congressman, heartbreaking defeat first race for Senate attainment, nonetheless, at age 31 he hungered. In this riveting book we are shown more clearly than every before true nature political genius.