Lone-pair–π (lp–π) interactions can differ in strength and origin. Water–indole, water–uracil, chloride–TCB lp–π have very different electrostatic (ES), polarization (POL), charge transfer (CT), dispersion (DISP) components.

An alternative to classical? In square-planar d8 complexes the metal ion can interact with axial H2O molecules either as a Lewis acid or base. Ab initio calculations predicted that uncharged PtII form hydrogen-bond-like interaction H2O, in which acts Such nonclassical OH⋅⋅⋅Pt hydrogen bond has now been identified crystals of trans-[PtCl2(NH3)(N-glycine)]⋅H2O by neutron diffraction.

Most and least electrostatic repulsive parts of a complex presented by red blue isosurface potential energy density.

The origin of the anomalous H8 chemical shifts observed in 1H-NMR spectra oligonucleotides cross-linked at a GpG sequence with cis-[Pt(NH3)2]2+ has been investigated and clarified. main contributions that distinguish resonances two platinum-ligating guanines from other GH8 signals each are: (a) inductive effect platinum binding which we have recently quantified as downfield shift 0.48 +/- 0.07 ppm (M. H. Fouchet, D. Lemaire, J. Kozelka J.-C. Chottard, unpublished results); (b) ring-current...

ADVERTISEMENT RETURN TO ISSUEPREVArticleNEXTMolecular mechanics calculations on cis-[Pt(NH3)2{d(GpG)}] adducts in two oligonucleotide duplexesJiri Kozelka, Gregory A. Petsko, Stephen J. Lippard, and Gary QuigleyCite this: Am. Chem. Soc. 1985, 107, 13, 4079–4081Publication Date (Print):June 1, 1985Publication History Published online1 May 2002Published inissue 1 June 1985https://doi.org/10.1021/ja00299a055RIGHTS & PERMISSIONSArticle Views92Altmetric-Citations63LEARN ABOUT THESE METRICSArticle...

Which cisplatin form reacts with DNA? Rate constants determined for the platination of hairpin-stabilized duplexes I and II (see picture) 1) monoaquated complex cis-[PtCl(NH3)2(H2O)]+, considered currently as actual species which binds to DNA, 2) diaqua cis-[Pt(NH3)2(H2O)2]2+ , 3) conjugate base latter, cis-[Pt(OH)(NH3)2(H2O)]+, suggest that undergoes double hydrolysis before reacting DNA. The double-stranded oligonucleotides d(TATGGTATT4ATACCATA) (I) d(TATAGTATT4ATACTATA) (II) were allowed...

Abstract In order to assess the geometric changes caused when antitumor drug cis ‐diammine‐dichloroplatinum(II) ( ‐DDP) binds DNA, molecular mechanics calculations were performed on two double‐stranded and single‐stranded oligonucleotides their adducts with ‐{Pt(NH 3 ) 2 } 2+ . For platinated duplexes, three model structures have been derived, one involving only local disruption of base pairing retention helix directionality, models showing pronounced kinking double helix. One kinked is...

ADVERTISEMENT RETURN TO ISSUEPREVArticleNEXTHigh-salt and low-salt models for kinked adducts of cis-diamminedichloroplatinum(II) with oligonucleotide duplexesJiri Kozelka, Gregory A. Petsko, Gary J. Quigley, Stephen LippardCite this: Inorg. Chem. 1986, 25, 8, 1075–1077Publication Date (Print):April 1, 1986Publication History Published online1 May 2002Published inissue 1 April 1986https://pubs.acs.org/doi/10.1021/ic00228a002https://doi.org/10.1021/ic00228a002research-articleACS...

An MP2 ab initio study of the interaction between a H(2)O molecule and trans-[Pt(OH)(2)(NH(3))(2)] revealed HO-H small middle dot dotPt(II) hydrogen bond (see picture) with strong dispersion component (ca. 4 kcal mol(-1)). This is independent charge on complex likely to be ubiquitous in aqueous solutions Pt(II) complexes.

The cytotoxic, pyrazolato-bridged dinuclear platinum(II) complex [(cis-{Pt(NH3)2})2(mu-OH)(mu-pz)]2+ (pz=pyrazolate) has been found to cross-link two adjacent guanines of a double-stranded DNA decamer without destabilizing the duplex and changing directionality helix axis. A 1H NMR study oligonucleotide d(CTCTG*G*TCTC)-d(GAGACCAGAG), cross-linked at G* by [(cis-{Pt(NH3)2})2(mu-pz)]3+, molecular dynamics simulations explicitly solvated were performed characterize structural details adduct....

ADVERTISEMENT RETURN TO ISSUEPREVArticleNEXTcis-Diamminediaquaplatinum(II) selectivity for GpG: influence of the adjacent base on first platination stepAbdelazize Laoui, Jiri Kozelka, and Jean Claude ChottardCite this: Inorg. Chem. 1988, 27, 16, 2751–2753Publication Date (Print):August 1, 1988Publication History Published online1 May 2002Published inissue 1 August 1988https://pubs.acs.org/doi/10.1021/ic00289a002https://doi.org/10.1021/ic00289a002research-articleACS PublicationsRequest reuse...

The "inverse hydration" of neutral complexes Pt(II) by an axial water molecule, whose one OH-bond is oriented toward Pt, has been the subject recent works, theoretical as well experimental. To study influence ligands on this non-conventional H-bond, we extend here our previous energy calculations, using second-order Moeller-Plesset perturbation theory (MP2) method together with Dolg-Pélissier pseudopotential for platinum, to various including well-known chemotherapeutic agent "cisplatin"....

Using concentration measurements based on high performance liquid chromatography, we have investigated the kinetics of reaction between single-stranded oligonucleotides containing a d(GpG) sequence, i.e., d(GG), d(TGG), d(TTGG), and d(CTGGCTCA), platinum complexes cis-[Pt(NH(3))(2)(H(2)O)(2)](2+) (1) [Pt(NH(3))(3)(H(2)O)](2+) (2). The rate constants for substitution one aqua ligand in 1 or 2 by each guanine were individually measured, as well as, 1, those subsequent conversion monoadducts to...

A model compound of the second most abundant DNA adduct antitumor agent cisplatin has been synthesized and structurally spectroscopically characterized its conformational behavior examined: cis-[(NH(3))(2)Pt(9-MeA-N7)(9-EtGH-N7)](NO(3))(2).2H(2)O (9-MeA = 9-methyladenine; 9-EtGH 9-ethylguanine) crystallizes in monoclinic system, space group P2(1)/n (No. 14) with a 7.931(2), b 11.035(3), c 26.757(6) Å, beta 94.94(2) degrees, Z 4. The two purine bases adopt head-to-head orientation, NH(2)...

Abstract The kinetics of the reactions between GG‐containing double‐stranded oligonucleotide d(TTGGCCAA) 2 ( II ) and platinum complexes cis ‐[Pt‐(NH 3 (H O) ] 2+ 1 [Pt(NH ‐(H O)] were studied compared with those already determined for single‐stranded octanucleotide d(CTGGCTCA) I ). [1] results as follows: i) Complex reacted faster than both . ii) Both This acceleration was greater (x 13) (x4) only due to increase platination rate 5′‐G GG sequence. iii) For , first by on 3′‐G. difference...

Several proteins that specifically bind to DNA modified by cisplatin, including those containing HMG-domains, mediate antitumor activity of this drug. Oligodeoxyribonucleotide duplexes a single, site-specific interstrand cross-link cisplatin were probed for recognition the rat chromosomal protein HMGB1 and its domains A B using electrophoretic mobility-shift assay. It has been found full-length domain which lysine-rich region (seven amino acid residues) A/B linker is attached at N-terminus...

The influence of the presence DNA on kinetics cisplatin (cis-[PtCl2(NH3)2]) aquation (replacement Cl- by H2O) and anation H2O Cl-) involved in hydrolysis have been determined two-dimensional [1H,15N] HMQC NMR spectroscopy. Single-stranded dT20 double-stranded [d(AT)10]2 oligonucleotides were used as models, avoiding guanines which are known to react rapidly with aquated forms. Reactions starting from cis-[PtCl2(15NH3)2], or a stoichiometric mixture cis-[Pt(15NH3)2(H2O)2]2+ (all 0.5 mM...

Abstract N ‐Aminoguanidine (Amgu) was examined for its behaviour as a ligand platinum(II) and palladium(II). Protonated AmguH + can coordinate platinum monodentate bound via the N4 amino group. Deprotonated, electrically neutral Amgu forms chelate complexes with both Pt II Pd ; in these is coordinated to metal by group deprotonated N1 imino group, forming five‐membered ring. K[PtCl 3 (dmso)] reacted · HCl yield complex trans S, suggesting that an exchange between binding sites followed...

The kinetics of the reactions between diaqua form antitumor drug cisplatin, cis-[Pt(NH3)2(H2O)2]2+, and two hairpin-stabilized duplex oligonucleotides, d(TATGGTATTTTTATACCATA) (I) d(TATAGTATTTTTATACTATA) (II), were investigated. Oligonucleotides I II used as models for GG AG sequences within DNA, which are known major sites platinum binding. guanines shown to react with similar rates (k5' = 18 ± 2 k3' 15 1 M-1 s-1), roughly twice fast guanine (k3' 9 s-1). Platination adenine was also...