Identification of a Novel AMP-activated Protein Kinase β Subunit Isoform That Is Highly Expressed in Skeletal Muscle

• DOI: 10.1074/jbc.273.20.12443
• Publication Date: 2002-07-26T15:13:03Z
• Authors: Claire Thornton; Michael A. Snowden; David Carling
• Keywords: AMP-Activated Protein Kinase

The AMP-activated protein kinase (AMPK) is a member of growing family related kinases, including the SNF1 complex in yeast, which respond to nutritional stress. AMPK heterotrimeric catalytic subunit (α) and two regulatory subunits (β γ), proteins all three have been identified complex. We used two-hybrid system order identify interacting with (α2). Using this approach, we isolated novel AMPKβ isoform, designate AMPKβ2. N-terminal region β2 differs significantly from that previously characterized isoform (β1), suggesting could play role isoform-specific activity. Comparison C-terminal sequences β1 their yeast identifies highly conserved regions predicted be involved binding α γ subunits. expression was examined number tissues, revealing expressed liver low skeletal muscle, whereas opposite pattern observed for isoform. These results suggest β isoforms tissue-specific roles, may involve altered responses upstream signaling and/or downstream targeting In mammals, 1The abbreviations are: AMPK, kinase; AMPKK, EST, sequence tag; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction; SAMS, synthetic peptide substrate HMRSAMSGLHLVKRR. plays major response metabolic stress (1Corton J.M. Gillespie J.G. Hardie D.G. Curr. Biol. 1994; 4: 315-324Abstract Full Text PDF PubMed Scopus (395) Google Scholar, 2Hardie Carling D. Halford N. Semin. Cell 5: 409-416Crossref (80) 3Hardie Cell. Signalling. 6: 813-821Crossref (22) Scholar). AMP activates via independent mechanisms, activation an (AMPKK), turn phosphorylates (4Hardie Eur. J. Biochem. 1997; 246: 259-273Crossref (1141) 5Hawley S.A. Selbert M.A. Goldstein E.G. Edelman A.M. Chem. 1995; 270: 27186-27191Abstract (365) effects are antagonized by high concentrations ATP so it appears responds AMP/ATP ratio, rather than itself Once activated, enzymes biosynthetic pathways causing inactivation preventing further utilization. findings led hypothesis has evolved monitor energy status, or fuel supply, within cell (2Hardie 4Hardie Molecular characterization revealed composed distinct subunits: subunit, (molecular mass approximately 63 kDa); subunits, (30 kDa) (36 (6Carling Aguan K. Woods A. Verhoeven A.J.M. Beri R.K. Brennan C.H. Sidebottom C. Davison M.D. Scott 269: 11442-11448Abstract 7Dyck J.R.B. Gao G. Widmer Stapleton Fernandez C.S. Kemp B.E. Witters L.A. 1996; 271: 17798-17803Abstract (163) 8Mitchelhill K.I. House Michell B. Katsis F. 2361-2364Abstract 9Stapleton B.J. Mitchelhill Teh T. C.M. 29343-29346Abstract 10Woods Cheung P.C.F. Smith F.C. 10282-10290Abstract (218) vitro studies indicate interact directly, do not form stable interaction (10Woods formation therefore mediated, at least part, subunit. Proteins Saccharomyces cerevisiae, derepression glucose-repressible genes (11Celenza J.L. Carlson M. Science. 1986; 233: 1175-1180Crossref (511) AMPKα 47% identical Snf1p (we refer individual as Snf1p, etc., SNF1) Scholar), AMPKγ 35% Snf4p Scholar,12Gao Auster A.S. Dyck 8675-8681Abstract (114) Sip1p/Sip2p/Gal83p 12Gao addition primary similarities, complexes functionally since SNF1, like inactivates acetyl-CoA carboxylase (13Woods Munday M.R. Yang X. 19509-19515Abstract Indeed, similarities between extend even recently shown active e.g. under glucose derepressing conditions, most likely exists Snf4p, one (14Jiang R. Genes Dev. 10: 3105-3115Crossref (241) 15Jiang Mol. 17: 2099-2106Crossref (205) Furthermore, analogous mediated Scholar,15Jiang A second recently, termed, somewhat unconventionally, α1 (the first becoming α2) (16Stapleton Cox 611-614Abstract (564) It reported accounted virtually activity measurable rat extracts α2 inactive but subsequent study challenged finding (17Woods Salt I. FEBS Lett. 397: 347-351Crossref (230) Immunoprecipitation specific show both contribute equally recombinant enzyme demonstrate comparable activities only difference detected specificity substrates Although subtle, does raise possibility there differences targets vivo leading different physiological roles α2. attempt screened library AMPKα2 bait. Here, report identification AMPKβ, muscle. amino acid Sip2p Gal83p reveal regions, diverge N termini, important conferring specificity, either intracellular locations responding stimuli. human muscle pGAD10 obtained CLONTECH. pYTH9 make fusion DNA-binding domain Gal4 gift Dr. Julia White, GlaxoWellcome Research Group. Yeast strain Y190 screening, standard methods were manipulation growth (18Sherman Methods Enzymol. 1991; 194: 3-21Crossref (2543) Oligonucleotides Genosys. CCL13 cells American Type Culture Collection grown Dulbecco's modified Eagle's medium supplemented 10% fetal calf serum. remove internalXbaI site, cDNA amplified reaction (PCR) following oligonucleotides: AGATCGGACACTACGTG (forward primer) CCTCATCATCGATGCTTTTAAAGTCCAGAAG (reverse primer). product digested withClaI BglII ligated (ClaI/BglII). round amplification carried out on using primers: GAGCTCAGGTCGACGCCCATGGCTGAGAAGC TCTGTCAGGAATTCAGAAAGACAGAGACCG. SalI EcoRI (restriction sites underlined primers) cloned into theSalI-EcoRI plasmid yield pYTH9α2. For mammalian expression, cDNAs pCDNA3 vector (Invitrogen). Plasmid DNA prepared QIAGEN maxiprep kit according manufacturer's instructions. pYTH9α2 linearized XbaI integrated genome Y190. Competent transformed plated selective lacking histidine, leucine, tryptophan. After incubation 10 days 30 °C, filter lifts colonies taken Whatman No. 3MM paper replicated onto fresh plates before being permeabilized immersing twice liquid nitrogen 5 s. Filters incubated 5-bromo-4-chloro-3-indoyl β-d-galactoside room temperature 1 h, positive clones appearance blue colonies. position marked replica plates, these overnight °C. Positive individually transferred leucine tryptophan isolate single Where appropriate, extracted 1.5-ml cultures transform Escherichia coli. inserts PCR primers GADF1 (GATAAGATACCCCACCAAACCC) GADR1 (CTTGCGGGGTTTTTCAGTATCTACG) flanking cloning sites. Following extended hot start min 95 35 cycles °C min, 56 72 used. Products analyzed electrophoresis after digestion RsaI,Sau3A, HaeIII. Clones grouped restriction digest pattern, separate each group original E. sequenced dideoxy termination method (19Sanger Nicklen S. Coulson A.R. Proc. Natl. Acad. Sci. U. 1977; 74: 5463-5467Crossref (52678) Scholar) Sequenase (version 2.0 Amersham Pharmacia Biotech) accordance nucleotide search dbEST (Expressed Sequence Tag) data base BLAST (Basic Local Alignment Search Tool) program. Two (accession numbers H06094 R20494) IMAGE consortium. sequenced. multiple tissue Northern blot (CLONTECH) probed random-primed AMPKβ1 AMPKβ2 cDNA. hybridization blots washed 2 × SSC, 0.5% SDS followed 0.2 60 autoradiographed 1–5 −70 Peptides based (residues 20–33, PRRDSSGGTKDGDR) 44–57, SVFSLPDSKLPGDK) synthesized coupled keyhole-limpet hemocyanin cysteine residue added terminus peptide. conjugated peptides immunize sheep (AMPKβ1-specific peptide) rabbits (AMPKβ2-specific peptide). some cases, antibodies affinity-purified serum appropriate thiol-Sepharose (20Duggan M.J. Stephenson A.F. 1990; 265: 3831-3835Abstract Affinity-purified bound A-Sepharose (rabbit antibodies) G-Sepharose (sheep immunoprecipitate extracts. comparison partially purified chromatography DEAE-Sepharose (21Carling Clarke P.R. Zammit V.A. 1989; 186: 129-136Crossref (343) mouse monoclonal antibody (clone 9E10; Ref. 22Evans G.I. Lewis G.K. Ramsay Bishop B.M. 1985; 3610-3616Crossref (2167) (in myc EQKLISEEDL terminus) transiently transfected cells. Extracts precleared rabbit preimmune h 4 then excess 2–16 Immune collected centrifugation 6000 ×g extensively buffer (50 mm Tris-HCl, pH 7.5, 50 NaF, sodium pyrophosphate, EDTA, dithiothreitol, (v/v) glycerol, 1% Triton X-100), Western blotting. Samples resolved SDS-PAGE polyvinylidene difluoride membrane. membrane blocked 7.4, 0.5m NaCl, Tween 20, 5% fat milk powder same 2–4 temperature. extensive washing 0.5 m horseradish peroxidase (for raised rabbits) G antibodies). washing, developed enhanced chemiluminescence (Boehringer Mannheim). encoding constructed RNA transcripts T7 translated reticulocyte lysates transcription/translation (TNT system, Promega) presence [35S]methionine. Total labeled products translation fluorography. pCDNA3. 10-amino epitope tag derived c-Myc (EQKLISEEDL; immediately initiating methionine. (10 μg plasmid) calcium phosphate precipitation (23Chen Okayama H. 1987; 7: 2745-2752Crossref (4821) precipitate overnight, 2-min phosphate-buffered saline containing dimethyl sulfoxide. Cells harvested transfection lysed Insoluble material removed supernatant blotting immunoprecipitation anti-AMPK anti-Myc (22Evans Activity measured phosphorylation SAMS described (24Davies S.P. 123-128Crossref (373) total 2.3 million screened, 136 blue/white selection lacZ reporter gene. Grouping mapping partial sequencing clones, AMPKβ2, shared considerable identity representative clone its entirety, Fig. 66.7% β1, 70.6% determine whether had homologue searched EST sequences. sequences, which, although did match β2. (with accession encoded corresponding (including methionine) consortium through UK Human Genome Mapping Resource Center, Cambridge. analysis they identical, except 343-base pair deletion compared R20494 (see Fig.1 B). R20494, At level, 89% (97% identity) 66% β2, therefore, 71% aligned Fig.2 divergent spanning 75 acids (40% identity), N-myristoylation signal (25Johnson R.D. Bhatnagar R.S. Knoll L.J. Gordon J.I. Annu. Rev. 63: 869-914Crossref (371) while remaining conserved. shares Bshows alignment members (Sip2p Gal83p) strong degree conservation four can identified, residues 79–155 203–270 β1. Poly(A)-rich tissues Fig.3. mRNA band 3 kilobase pairs equal levels. 7.5 probe, case clearly expression. Relatively levels cardiac kidney lung. Antibodies against tissues. Preliminary experiments possible detect directly (data shown), homogenates immunoprecipitated A- immune SDS-PAGE, Fig.4 shows isoforms. very prominent migrating kDa, blots, due cross-reaction IgG heavy chains, present immunoprecipitation, A/G-conjugated detection antibody. case, however, additional ahead band, detected. highest brain level kidney, liver, time, cannot explain why doublet molecular migrate anomalously SDS-PAGE. previously, migrates apparent 38 kDa 34 (Fig. A). lysate similar discrepancy migration able reason anomalous clear relative investigate more detail, ion-exchange β1- β2-specific antibodies. determined much higher recovered β1-specific antibody, obtain linear rate necessary use 50-fold lower amount extract when immunoprecipitating Despite starting material, still greater C), nearly associated contrast, yields activities. determination activity, α1- α2-specific Both D). quantitative, draw general conclusions them regarding amounts (both α1β1γ α2β1γ) abundant (compare lanes 1and D), consistent reverse true, (comparelanes 4). same, C). α1/β1/γ1, α1/β2/γ1, α2/β1/γ1, α2/β2/γ1 co-transfected (a Myc determined. No significant β1-containing β2-containing (Fig.5 As those correspondingly (7Dyck recognizes Transfections transfections kDa. untransfected There no immunoprecipitates α2-transfected cells, indicating α2, co-transfection α, β, required shown). here (termed β2),