Viral Evolution as a Tool to Improve the Tetracycline-regulated Gene Expression System

• DOI: 10.1074/jbc.m313895200
• Publication Date: 2004-04-23T18:58:10Z
• Authors: Atze T. Das; Xue Zhou; Monique Vink; Bep Klaver; Koen Verhoef; Giuseppe Marzio; Ben Berkhout
• Keywords: 0301 basic medicine; Operator Regions, Genetic; Genetic Variation; Tetracycline; Transfection; Virus Replication; Recombinant Proteins; 3. Good health; Repressor Proteins; 03 medical and health sciences; Gene Expression Regulation; Mutation; Escherichia coli; HIV-1; Humans; Cloning, Molecular; Directed Molecular Evolution; Biotechnology; HeLa Cells

We present viral evolution as a novel and powerful method to optimize non-viral proteins. used this approach the tetracycline (Tc)-regulated gene expression system (Tet system) for its function in mammalian cells. The components of Tet were incorporated human immunodeficiency virus (HIV)-1 such that replication is controlled by regulatory system. Upon long term HIV-rtTA T cells, we obtained variant with an enhanced potential resulting from improved rtTA component introduced identified single amino acid exchange, F86Y, which enhances transcriptional activity doxycycline (dox) sensitivity rtTA. generated new 5-fold more active at high dox levels than initial rtTA, 25-fold sensitive dox, whereas background absence not increased. This will be very useful biological applications require or Our results demonstrate strategy can improve genes making them integral essential part virus. Technology regulation cells tissues primary importance wide variety basic applied research areas, including functional genomics, therapy, animal models diseases, biopharmaceutical protein production. All these production protein(s) interest regulated both quantitative temporal way. For purpose, artificial systems have been developed are effector molecules dose-dependent reversible manner. most frequently circuit so-called system, allows stringent control (Tc) 1The abbreviations are: Tc, tetracycline; doxycycline; r, reverse; HIV-1, virus, type 1; FBS, fetal bovine serum; CMV, cytomegalovirus; ELISA, enzyme-linked immunosorbent assay; TAR, trans-acting response region; LTR, terminal repeat; wt, wild type; CSR, compartmentalized self-replication. derivative (1Gossen M. Bujard H. Nelson Hillen W. Greenwald R.A. Tetracyclines Biology, Chemistry Medicine. Birkhäuser Verlag, Basel2001: 139-157Google Scholar, 2Baron U. Methods Enzymol. 2000; 327: 401-421Google 3Freundlieb S. Baron Bonin A.L. Gossen 1997; 283: 159-173Google Scholar). based on specific, affinity binding Escherichia coli repressor (TetR) tet operator (tetO) sequence. Tc induce conformational change TetR, impedes interaction tetO. Fusion activation domain herpes simplex VP16 TetR resulted activator tTA, induces promoters placed downstream tetO elements (Ptet) eukaryotic presence abolishes expression. A tTA four substitutions moiety exhibits reverse phenotype (4Gossen Freundlieb Bender G. Muller Science. 1995; 268: 1766-1769Google (rtTA) binds Ptet, activates but absence. now widely eukaryotes, mammals, plants, insects (reviewed Ref. 1Gossen Since originates bacterial it seems likely optimized their cells.A commonly alter specific directed evolution, involves genetic diversification followed selection. mimics natural guided accelerated fashion. In first step approach, cloned DNA sequences, example encoding protein, mutated via random mutagenesis recombination, library related mutant sequences. second step, sequences selected through careful screening vitro vivo assay. Directed has activity, selectivity, stability enzymes Refs. 5Farinas E.T. Bulter T. Arnold F.H. Curr. Opin. Biotechnol. 2001; 12: 545-551Google Scholar 6Sutherland J.D. Chem. Biol. 4: 263-269Google Scholar) also vector (7Powell S.K. Kaloss M.A. Pinkstaff A. McKee R. Burimski I. Pensiero Otto E. Stemmer W.P. Soong N.W. Nat. 18: 1279-1282Google Scholar), cytokine efficacy (8Leong S.R. Chang J.C. Ong Dawes Punnonen J. Proc. Natl. Acad. Sci. 2003; 100: 1163-1168Google antibody fragment (9Boder Midelfort K.S. Wittrup K.D. 97: 10701-10705Google Recently, Yokobayashi et al. (10Yokobayashi Y. Weiss 2002; 99: 16587-16591Google successfully comprising simple demonstrated nonfunctional containing improperly matched could evolve rapidly into one 11Hasty 16516-16518Google success direct depends realization sufficiently large diversity effectiveness selection procedure.Previous optimizations introduction rationally designed mutations, scale was mutants yeast assay (12Urlinger Thellmann Hasan M.T. 7963-7968Google 13Baumeister Helbl V. Mol. 1992; 226: 1257-1270Google 14Baron Schnappinger D. 1999; 96: 1013-1018Google 15Baron Nucleic Acids Res. 25: 2723-2729Google However, approaches labor intensive, mutations may improvements higher eukaryotes. here HIV-1 During continuously due error-prone transcription process, outgrowth faster replicating variants. Thus, generation variants combined approach. way, HIV capacity rtTA-component observed mutation does only system.EXPERIMENTAL PROCEDURESCells Viruses—SupT1 grown 37 °C 5% CO2 RPMI 1640 medium 10% serum (FBS), 100 units/ml penicillin, streptomycin. SupT1 transfected molecular clones electroporation. Briefly, 5 × 106 washed 20% FBS mixed 1–10 μg 250 μl FBS. Cells electroporated 0.4-cm cuvettes V 960 microfarads subsequently resuspended split 1 10 twice week.HeLa X1/6 (15Baron derivatives HeLa cervix carcinoma cell line harbor chromosomally integrated copies CMV-7tetO promoter/luciferase reporter construct pUHC13–3 (16Gossen 89: 5547-5551Google C33A (ATCC HTB31) (17Auersperg N. Cancer Inst. 1964; 32: 135-163Google monolayer Dulbecco's modified Eagle's supplemented minimal nonessential acids, calcium phosphate method. ml culture 2-cm2 wells 24-well plate 60% confluence. 15 water 25 50 mm HEPES (pH 7.1)-250 NaCl-1.5 Na2HPO4 0.6 m CaCl2, incubated room temperature 20 min, added medium. refreshed after 16 h.The incorporation genome described previously (18Verhoef K. Marzio Berkhout B. Virol. 75: 979-987Google HIVrtTA study KYK version, contains inactivating Y26A Tat five nucleotide TAR (trans-acting region) hairpin motif. rtTA2S-S2 place nef eight LTR promoter region.For viruses capacity, clone cultured μg/ml (Sigma) up 114 days. When HIV-induced cytopathic effects seen, level maintained passage cell-free supernatant onto uninfected Cell samples isolated stored -80 °C. An HIVLAI stock produced transfection corresponding (19Peden Emerman Montagnier L. Virology. 1991; 185: 661-672Google Virus quantitated CA-p24 antigen ELISA (Abbott) (20Back N.K.T. Nijhuis Keulen Boucher C.A.B. Oude Essink B.B. van Kuilenburg A.B.P. Van Gennip A.H. EMBO 1996; 15: 4040-4049Google Scholar).Proviral Analysis Cloning Revertant Sequences—HIV-1-infected pelleted centrifugation 4000 rpm 4 min phosphate-buffered saline. solubilized resuspending Tris-HCl 8.0)-1 EDTA-0.5% Tween 20, incubation 200 proteinase K/ml 56 30 95 min. Proviral PCR amplified total cellular DNA, using 5′ primer nef-seq1 (positions upstream translation start site) 3′ U3 anti-U3-att 63 44 stop codon). fragments digested XcmI SmaI sites shuttle pBlue3′LTRext-ΔU3-rtTA-2ΔtetO, identical pBlue3′LTRext-ΔU3-rtTA-K8-TAR* 2ΔtetO configuration (21Marzio Verhoef Vink 98: 6342-6347Google 22Marzio de Ronde 76: 3084-3088Google Sequence analysis performed big dye terminator cycle sequencing (PE Biosystems). construction F86Y mutant, F86Y-containing XcmI-NdeI pBlue3′LTRext-ΔU3-rtTAF86Y A209T-2ΔtetO replace sequence pBlue3′LTRext-ΔU3-rtTA-2ΔtetO create pBlue3′LTRext-ΔU3-rtTAF86Y-2ΔtetO. cloning provirus, BamHI-BglI vectors HIVrtTA.The plasmid pCMV-rtTA pUHD141–1/X XbaI-SmaI pBlue3′LTRext-ΔU3-rtTAF86Y-2ΔtetO pCMV-rtTA, pCMV-rtTAF86Y A209T, respectively. plasmids pCMV-rtTAS12G A209T constructed site-directed oligonucleotide 5′-ATAACCATGTCTAGACTGCACAAGAGCAAAGTCATAAACGGAGCTCTGGAATTACTCAATGGTGTCGGTATCGAAGGCCTGACGACAAGGAAACTCGCT (mutated codon underlined) annealed 5′-AGCAGGGCCCGCTTGTTCTTCACGTGCCAGTACAGGGTAGGCTGCTCAACTCCCAGCTTTTGAGCGAGTTTCCTTGTCGTCAGGCCTTCGA, strands completed Klenow polymerase dNTPs, ApaI, respectively.rtTA Activity Assay—In pLTR-2ΔtetO-lucff firefly luciferase under LTR-2ΔtetO-promoter (22Marzio pCMV-7tetO-lucff seven coupled CMV promoter. named pRL-CMV, renilla promoter, co-transfected allow correction differences efficiency.C33A 0.4 ng (wild mutant), 0.5 either pCMV-7tetO-lucff. 8 2.5 pRL-CMV. pBluescript mix DNA. 48 h different concentrations. lysed passive lysis buffer Renilla activities determined dual-luciferase (Promega). within linear range no squelching observed. ratio between reflects proteins.Western Blot Analysis—HeLa 90% confluency wild-type 2 LipofectAMINE 2000 (Invitrogen) wells. lysate reducing SDS sample (100 6.8), 4% SDS, β-mercaptoethanol, glycerol). Proteins resolved SDS-10% polyacrylamide gel, transferred Immobilon-P membrane (1 h, 80 V), blocked saline nonfat dry milk. immunochemical detection membranes rabbit polyclonal anti-TetR antibodies (23Krueger C. Berens Schmidt 31: 3050-3056Google Bound visualized peroxidase-linked anti-rabbit IgG ECL+ kit (Amersham Biosciences) analyzed Storm 860 Imager Biosciences).RESULTSThe System Essential Component Replication—We reported infectious critically dependent naturally nascent RNA transcript (24Berkhout Silverman R.H. Jeang K.T. Cell. 1989; 59: 273-282Google thereby 25Jeang Xiao Rich E.A. 274: 28837-28840Google variant, Tat-TAR mechanism inactivated functionally replaced (Fig. 1A). inserted 3′-terminal gene, replicate dox. Administration proteins, transcription, expression, replication. Other groups tried implement SIV (simian virus), attempts failed produce efficiently (26Smith S.M. Khoroshev Marx P.A. Orenstein 276: 32184-32190Google 27Xiao Kuwata Miura Hayami Shida 269: 268-275Google Although our initiate spreading infection relatively poor when compared parental Instead trying additional molecular-biological manipulations, set out let nature select capacity.Improved Viral Replication Evolution-driven Optimization Gene—We characteristic LTR-tetO occurred multiple, independent cultures particular greatly changes protein. Genetic days indicated had acquired two protein; phenylalanine position 86 tyrosine (F86Y) alanine 209 threonine (A209T; Fig. striking because strictly conserved residue contact Tc/dox molecule 1C). To directly compare evolved HIVrtTA, original HIVLAI, infected equal amounts 1B). significantly approached HIVLAI. Like dox.To responsible improvement replication, individual (HIVrtTA-F86Y) (HIVrtTA-F86Y A209T) assayed concentrations 2). fully isolate influenced included 2A). did low ng/ml 2B). Increasing concentration gradual increase rate. HIVrtTA-F86Y completely already apparent 2C). At concentration, replicates even 1000 showed same dependence 2D). These indicate sufficient superior confirmed competition experiment HIVrtTA. dominated population week (more 80% population-based sequence), exclusively detected later times (results shown).Fig. 2The improves upon prolonged culturing Molecular μg) (A), (B), (C), (D), all LTR-2ΔtetO (0–1000 ng/ml). monitored samples.View Large Image Figure ViewerDownload (PPT)We tested effect transiently transfecting wt proviral genomes support virion do they lack appropriate receptors. gradually increases increasing reaches maximal 3). dox-dependent, reached concentrations.Fig. 3rtTA measured transfection.View (PPT)The Evolved Variant Greatly Improves System—To test whether rtTAs regular context. Expression (rtTAwt) proteins (rtTAF86Y rtTAF86Y 4A). show 4B). rtTAwt detectable 500 further ng/ml. ng/ml, Moreover, ∼4-fold levels. Identical confirming solely increased activity.Fig. 4Evolved systems. A, differ tetO-promoter reporter-gene configuration. carrying (LTR-2ΔtetO; B) CMV-derived (CMV-7tetO; C). Furthermore, HeLA contain copy (CMV-7tetO-integrated; D). (rtTAwt, rtTAF86Y, (-; rtTA) constitutively expressing correct efficiency. ng/ml), protein.View (PPT)This optimization spontaneous adaptation since similar assays standard operators 4C). 4D). Also much lower rtTAwt, episomal chromosomal status promoter.In studies, Urlinger recently S12G activity. made (rtTAS12G; rtTA2S-M2 12Urlinger (rtTAS12G A209T). combination (Table I). rtTAS12G indeed lowest less Combining yielded highest reach comparable needs 40 translated Importantly, like other mutants, any optimal performance obvious considering fold induction induced 47-fold,