Phosphorylation of MCM4 by Cdc7 Kinase Facilitates Its Interaction with Cdc45 on the Chromatin
0303 health sciences
Sequence Homology, Amino Acid
Molecular Sequence Data
DNA Helicases
Nuclear Proteins
Cell Cycle Proteins
Protein Serine-Threonine Kinases
Chromatin
Minichromosome Maintenance Complex Component 4
Protein Structure, Tertiary
DNA-Binding Proteins
Mice
03 medical and health sciences
Animals
Humans
Amino Acid Sequence
Phosphorylation
DOI:
10.1074/jbc.m608935200
Publication Date:
2006-10-18T02:47:29Z
AUTHORS (13)
ABSTRACT
Cdc7 kinase, conserved from yeasts to human, plays important roles in DNA replication. However, the mechanisms by which it stimulates initiation of replication remain largely unclear. We have analyzed phosphorylation MCM subunits during cell cycle examining mobility shift on SDS-PAGE. MCM4 chromatin undergoes specific S phase. phosphorylates complexes as well N-terminal polypeptide. Experiments with phospho-amino acid-specific antibodies indicate that phase-specific is due at (S/T)(S/T)P residues protein. These events are not observed mouse ES cells deficient or reduced treated siRNA Cdc7, suggesting they mediated kinase. The association Cdc45 chromatin, may be an event for activation origins. Deletion non-conserved 150 amino acids results growth inhibition, and addition carrying putative target sequences partially restores growth. Furthermore, combination deletion alanine substitution segments MCM2 MCM6, respectively, contain clusters serine/threonine also likely targets led apparent nonviable phenotype. consistent notion MCM2, MCM4, MCM6 play functionally redundant but essential proceeds through series staged reactions involving various protein-DNA protein-protein interactions template DNA. In eukaryotes, origin recognition believed central origins function landing pads other factors including (minichromosome maintenance proteins) (1Bell S.P. Dutta A. Annu. Rev. Biochem. 2002; 71: 333-374Crossref PubMed Scopus (1385) Google Scholar, 2Bell Stillman B. Nature. 1992; 357: 128-134Crossref (983) Scholar). under strict regulation G1 signals, activated suppressed extracellular differentiation respectively (3Aguda B.D. Chaos. 2001; 11: 269-276Crossref (19) signals regulate Cdkcyclins ultimately activate E2F, leading components machinery protein kinases (4Nevins J.R. Cell Growth Differ. 1998; 9: 585-593PubMed Cdk2-cyclinE Cdc7-Dbf4 kinase among those known critical (5Coverley D. Laman H. Laskey R.A. Nat. Biol. 4: 523-528Crossref (237) 6Jares P. Blow J.J. Genes Dev. 2000; 14: 1528-1540PubMed 7Masai Arai K. J. Cell. Physiol. 190: 287-296Crossref (148) 8Masai Miyake T. EMBO 1995; 3094-3104Crossref (124) 9Sato N. Masai 1997; 16: 4340-4351Crossref (121) 10Sclafani Sci. 113: 2111-2117Crossref 11Woo Poon R.Y. Cycle. 2003; 2: 316-324Crossref (169) these understood, complexes, a role elongation stage (12Aparicio O.M. Weinstein D.M. Bell 91: 59-69Abstract Full Text PDF (637) 13Ishimi Y. Chem. 272: 24508-24513Abstract (457) 14Maine G.T. Sinha Tye B.K. Genetics. 1984; 106: 365-385Crossref Scholar), substrates (9Sato 15Lei M. Kawasaki Young M.R. Kihara Sugino 3365-3374Crossref (244) Among them, has been shown phosphorylated both vivo vitro Xenopus egg extracts mammalian (16Brown G.W. Kelly T.J. 273: 22083-22090Abstract (102) 17Cho W.H. Lee Y.J. Kong S.I. Hurwitz J.K. Proc. Natl. Acad. U. S. 2006; 103: 11521-11526Crossref (74) 18Ishimi Komamura-Kohno 276: 42744-42752Abstract (44) 19Masai Matsui E. You Z. Ishimi Tamai 275: 29042-29052Abstract (129) 20Montagnoli Valsasina Brotherton Troiani Rainoldi Tenca Molinari Santocanale C. 281: 10281-10290Abstract (166) 21Takahashi T.S. Walter J.C. 2005; 19: 2295-2300Crossref (55) 22Takeda Ogino Cho M.K. Kumagai Mol. 1999; 5535-5547Crossref (93) 23Takeda Tatebayashi Ikeda 12: 1257-1274Crossref (88) 24Walter 39773-39778Abstract (128) fission yeast, Hsk1 homologue budding yeast was phosphorylate MCM2-MCM4-MCM6-MCM7 complex (25Lee Seo Y.S. 100: 2334-2339Crossref precise Cdc7-mediated sites known, except recent report segment (17Cho nor significance known. Only recently, potential reported human (48Tsuji Ficarro S.B. Jiang W. 17: 4459-4472Crossref (89) this report, we discovered required phosphorylation. further identified loading onto chromatin. show data Synchronization Preparation Lysates—HeLa were arrested G1/S boundary two successive incubation medium containing 2.5 mm thymidine (24 h each) interval 12 without thymidine. Cells then released into harvested each time point. early 0.5 mimosine 24 h, 2 HU 2The abbreviations used are: HU, hydroxyurea; siRNA, small interfering RNA; GST, glutathione S-transferase; PCNA, proliferating nuclear antigen; HA, hemagglutinin; FACS, fluorescence-activated sorter; tg, transgene. followed fractionation Triton-soluble -insoluble (chromatin-enriched) fractions, described previously (26Fujita Kiyono Hayashi Ishibashi 10928-10935Abstract (76) 27Yoshizawa-Sugata Ishii Taniyama 280: 13062-13070Abstract (57) whole extract soluble supernatant sonicated CSK buffer Scholar) 0.1% Triton X-100. Each fraction applied 7.5% SDS-PAGE detected Western blotting. monitored flow cytometry analyses stained propidium iodine. Small Interfering RNA (siRNA) Transfection—Transfection purchased Japan Bio Services (Saitama, Japan), conducted using Oligofectamine (Invitrogen). Cdc7-1 (27Yoshizawa-Sugata Cdc7-D (28Montagnoli Sola F. Carpani Albanese Cancer Res. 2004; 64: 7110-7116Crossref (113) Cdc7-nc (guaaccccuuagcuggcauTT/augccagcuaagggguuacTT). Construction Expression Plasmids Mutant Proteins—The wild-type Mcm4 cDNA PCR mutagenesis mutate serine threonine glutamic acid. 6AA 6EE mutant represents mutants positions 2-4, 6-8, 30-32, 52-54, 69-71, 86-88 replaced (Ala) acid (Glu). Alanine glutamine MCM2(Cdc19) MCM4(Cdc21) constructed similar manner. constructions verified sequencing. form expressed baculovirus expression vector expressing MCM6. This virus MCM2-MCM7 (29You Komamura 8003-8015Crossref (171) coinfection insect express complex, purified preparation (19Masai Immunofluorescence Analyses—Cells, grown cover slides, washed twice phosphate-buffered saline, fixed 4% paraformaldehyde, permeabilized 0.5% iodide. For immunofluorescence, antibody 1 μg/ml, secondary (Alexa Fluor 546-labeled goat anti-mouse IgG) 1:250 dilution. Development Phosphopeptide Antibodies Other Antibodies—Antibodies developed rabbit against oligopepetides CMSSPASTPSRRGSRRG (1st 16th MCM4), 7th 6th (T7 S6T7 antibody, respectively). affinity-purified non-phosphorylated oligonucleotides remove reacting nonphosphorylated Anti-MCM4 GST-fused C-terminal polypeptide (683-861) same fused histidine tag. Anti-Cdc45 recombinant GST-Cdc45 Escherichia coli His-Cdc45 cells. 3K. Tamai, unpublished data. Anti-MCM3 MCM5 prepared bacterially proteins. Goat anti-MCM2 (sc-9831), anti-Cdc6 (sc-6316), monoclonal anti-PCNA (sc-56), anti-LaminB (sc-6217) Santa Cruz Biotechnology (Santa Cruz, CA). Anti-HA (mouse 16B12) Babco. Anti-α-tubulin monoclonal, B-5-1-2) Sigma. Anti-RPA (9H8) NeoMarkers (Fremont, MCM5(Nda4) proteins Dr. Susan Forsburg MCM6(Mis5) Hisao Masukata. Anti-Cdt1 Hideo Nishitani. Yeast Strains Plasmids—Methods genetic biochemical (30Matsumoto Noguchi Russell 42536-42542Abstract (53) following strains study: NI740 (h+ ade6-M210 ura4-D18 leu1-32), NI284 ade6-M216 leu1-32 cdc21-M68), CHP429 (h- ura4 leu1 his7), MS190 his7 cdc19-P1), MS210 Δcdc21::[Pnmt-cdc21:his7+]), MS211 ade6 Δcdc21::[Pnmt-Δ67cdc21:his7+]), MS213 Δcdc21::[Pnmt-Δ130cdc21:his7+]), MS240 Δ47mis5:kan), MS242 mis5:kan), Goa1-HA goa1-HA3 ura4-D14 ade6-M26) hsk1-89 hsk1-89:ura4+). Cdc19-A10 Cdc19-E10 Cdc19 (MCM2) 10 present within its 35-amino acid, respectively. pREP41-cdc19, pREP41-cdc19-A10, pREP41-cdc19-E10 pREP41 derivatives wild-type, Cdc19-A10, Cdc19-E10, RGSHis-tag. REP41X-AAP7cdc21 REP41X-EEP7cdc21 derivative Cdc21 (MCM4) all seven 129-amino AAP EEP sequence, 3×FLAG-tag. REP41X-Δ67cdc21, REP41X-Δ130cdc21, REP41X-Δ150cdc21, REP41X-Δ200cdc21 Cdc21-3FLAG 67, 130, 150, 200 deleted, Δ47mis5 lacking 47 residues. REP41X-mcm6NΔ150cdc21 carries 42 end point REP41X-Δ150cdc21-3FLAG. fragment amplified primers: SpMCM6-N(XhoI) ccgctcgagatgtcttctcttgcatctcag SpMCM-6-(47-41, XhoI) gctatgctcgaggatgatgga. Cycle-dependent Phosphorylation Human Protein—MCM4 phosphoprotein (31Fujita Yamada Tsurumi Hanaoka Matsuzawa Inagaki 17095-17101Abstract 32Pereverzeva I. Whitmire Khan Coue 20: 3667-3676Crossref (38) Therefore, examined cycle. HeLa synchronized release double block, arrests G1-S boundary. synchronous progression confirmed FACS iodide (Fig. 1A). Immediately after release, entered phase, completing 8 h. They underwent mitosis 10-14 reentered next phase 18-24 profiles former contains cytoplasmic latter chromatin-associated insoluble PCNA protein, associate forks (33Morris G.F. Mathews M.B. 1989; 264: 13856-13864Abstract Triton-insoluble fractions only until 6 18 later 1B). Cdt1 mainly 12-18 (34Nishitani Taraviras Lygerou Nishimoto 44905-44911Abstract (218) α-Tubulin, marker constitutively constant level whereas LaminB chromatinenriched verifying procedure. A portion decreased progressed. behaved manner; about half-population associates dissociates late G2/M remainder throughout previous displays characteristic At 0-6 slow migrating bands appeared again 16-20 release. eliminated prior treatment phosphatase (data shown), indicating caused highly mobility-shifted forms accumulated M (6-14 release). Cdc2 part strategies ensure inhibition rereplication Vitro MCM4—We whether vitro. substrate reactions. As previously, efficiently shifted downward Scholar; Fig. 2A). (as lower extent) Cdc7. 2A), one (and MCM6) lower, compared (∼4 molecules molecule ATP incorporated max average per + respectively; see supplemental S1). lack factors, such MCM10, enhance reaction region (see 7A). Some Cdk, since S/TPXR motif. Cdk fact demonstrated 35Ishimi 34428-34433Abstract (69) noticed repeated presence across species speculated generated alanine. “6AA” substitutions six MCM4(6AA) mutation did affect formation, could purified. Although MCM2-MCM4(6AA)-MCM6-MCM7 eliminated, indicated loss labeled 2A, top bottom panels, lanes 1-3 6-8). Interestingly, sets generate mimicking state, migrated anomalously SDS-PAGE, 11-15). Next, 198-amino Cdc2-CyclinB Cdc7-ASK Both 2B, 5). (compare 9 2B), significant still lane 2), 7A) can significantly increased compare 1, 5, 9), concerted action kinases. Similar stimulatory effect efficacy MCM4N than (∼0.2 maximum outside tail and/or facilitate multiple sites, some stimulated Cdk. Segment Is Phosphorylated Vivo—We specifically recognizes above (serine 7). designed phosphopeptide, phosphoserine phosphothreonine position, position. strongly reacted when incubated 2C, 3). blotting showed Tritoninsoluble indeed 12-14 cytoplasm Cdc7-ASKL1/Drf1 G2-M contrast, T7 7, amount peaked most Immunoprecipitation chromatin-enriched HU-treated indicates interaction between subunits. selective precipitation coimmunoprecipitation band 1C), 28Montagnoli suggests Since takes place continues responsible needs active junction stay fact, even G2 phases therefore appearance mobility-shifted, depends functions. line gene conditionally inactivated (36Kim J.M. Nakao Nakamura Saito Katsuki 21: 2168-2179Crossref Inactivation population th
SUPPLEMENTAL MATERIAL
Coming soon ....
REFERENCES (48)
CITATIONS (154)
EXTERNAL LINKS
PlumX Metrics
RECOMMENDATIONS
FAIR ASSESSMENT
Coming soon ....
JUPYTER LAB
Coming soon ....