Developmental Phenotype of a Membrane Only Estrogen Receptor α (MOER) Mouse

• DOI: 10.1074/jbc.m806249200
• Publication Date: 2008-12-04T01:13:18Z
• Authors: Ali Pedram; Mahnaz Razandi; Jin K Kim; Fiona O'Mahony; Eva YHP Lee; Ulrike Luderer; Ellis R. Levin
• Keywords: Estrogen receptor alpha

Estrogen receptors (ERs) α and β exist as nuclear, cytoplasmic, membrane cellular pools in a wide variety of organs. The relative contributions each ERα pool to vivo phenotypes resulting from estrogen signaling have not been determined. To address this, we generated transgenic mouse expressing only functional E domain at the plasma (MOER). Cells isolated many organs showed localized no other receptor pools. Liver cells MOER wild type mice responded 17-β-estradiol (E2) with comparable activation ERK phosphatidylinositol 3-kinase, seen ERαKO mice. Mating female proven male breeders produced pregnancies because uterus vagina were extremely atrophic. Ovaries homozygous Strasbourg multiple hemorrhagic cysts corpus luteum, mammary gland development both was rudimentary. Despite elevated serum E2 levels, LH suppressed, prolactin levels low plentiful abdominal visceral depots fat increased body weight compared despite food consumption. These results provide strong evidence that normal adult functions important requires nuclear is rescued by expression alone. (ER) 3The abbreviations used are: ER, receptor; WT, type; ERK, extracellular signal-regulated kinase; PI3K, 3-kinase; KO, knock-out; FITC, fluorescein isothiocyanate; LH, leuteinizing hormone; FSH, follicle-stimulating RT, reverse transcription; ERE, response element. exists locations, potentially contributing sex steroid action (1Levin E.R. Mol. Endocrinol.. 2005; 19: 1951-1959Google Scholar). Genetic deletion established roles this for reproductive tract function (2Lubahn D.B. Moyer J.S. Golding T.S. Couse J.F. Korach K.S. Smithies O. Proc. Natl. Acad. Sci. U. S. A.. 1993; 90: 11162-11166Google Scholar, 3Bocchinfuso W.P. Lindzey J.K. Hewitt S.C. Clark J.A. Myers P.H. Cooper R. Endocrinology.. 2000; 141: 2982-2994Google 4Dupont Krust A. Gansmuller Dierich Chambon P. Mark M. Development.. 127: 4277-4291Google In these regards, knock-out (KO) show atrophy vagina, abnormal ovarian histology, rudimentary development. As result, markedly compromised, abnormalities phenocopied aromatase (5Simpson Semin. Reprod. Med.. 2004; 22: 25-30Google Thus, or its metabolites acting necessary developmental functions. Since original descriptions Chapel Hill Scholar) (4Dupont mice, it has become appreciated represent depletion all For instance, endothelial derived ERα/ERβ combined any ER (6Pedram Razandi Levin 2006; 20: 1996-2009Google Furthermore, cannot rapidly signal nor stimulate proliferation survival cells. be determined where acts cell effect function. This limits understanding what specific actions occur through discrete pools, overall effects vivo. begin issue expresses No cytoplasmic found (MOER) mouse. allowed us investigate possible model lacking ERα. Materials—All antibodies Santa Cruz except FITC-conjugated (Vector Laboratories) C-terminal antibody (Abcam). Enzyme-linked immunosorbent assay kits hormone (LH), (FSH), prolactin, growth hormone, insulin-like factor 1, Diagnostic Systems Laboratories, Inc. R & D Systems. Generation Mice—The amplified PCR full-length human ERα-containing plasmid (pcDNA3-hERα) cloned into cloning site pECFP-mem (Clontech), slight changes previously described methods (7Kousteni Bellido T. Plotkin L.I. O'Brien C.A. Bodenner D.L. Han L. K. DiGregorio G.B. Katzenellenbogen B.S. Roberson P.K. Weinstein R.S. Jilka R.L. Manolagas Cell.. 2001; 104: 719-730Google extensively expressed cells, localizes palmitoylation sites neuromodulin protein parent 14Quyyumi A.A. J. Am. Coll Cardiol.. 47: S66-S71Google construct injected fertilized CB6F1 oocytes implanted pseudopregnant Founder first identified tail snip DNA, confirmed DNA extracted organs, using primers 5′-CGTGTACGGTGGGAGGTCTA-3′ (forward) 5′-ATGTGAACCAGCTCCCTGTC-3′ (reverse). amplification conditions 94 °C 5 min, 30 cycles 1 55 72 followed min. 226-bp product composed sequences sequencing. then bred heterozygous (kindly obtained Dr. Pierre Chambon, INSERM, France, Michael Mendelsohn, Tufts University), compound other, creating (see Fig. 1A). Deletion Briefly, two primer sets yield different patterns, identifying either Homozygous (ERα–/–) indicated absence P1 P2 (5′-TTGCCCGATAACAATAACAT-3′ 5′-ATTGTCTCTTTCTGACAC-3′, respectively) 255-bp P3 P4 (5′-GGCATTACCACTTCTCCTGGGAGTCT-3′ 5′-TCGCTTTCCTGAAGACCTTTCATAT-3′, respectively). Tail samples (ERα+/–) produce 387-bp band P4. Wild (ERα+/+) P2, an 815-bp primers. Establishing transgene done RT-PCR. Total RNA various cDNA synthesis, genotyping. quantify expression, synthesis performed. Real time carried out SYBR® GreenER™ qPCR SuperMix iCycler (Invitrogen) according manufacturer's manual. melting curve analysis performed following real ensure specificity reaction identify presence dimers. forward sequence detect were: 5′-AGCACCCTGAAGTCTCTGGA-3′ 5-GATGTGGGAGAGGATGAGGA-3′, respectively. change gene calculated ΔΔCt method glyceraldehyde-3-phosphate dehydrogenase internal control. Cell Culture—Mouse hepatocytes 6–12-week-old C57 Black/J6 (WT), MOER, enzymatic mechanical primary cultures experiments. addition, thin tissue sections gland, uterus, ovary prepared immunohistochemistry. Microscopy—Tissues cultured on glass slides incubated E/F A/B domains (Santa Biotechnology) overnight 4 °C. second conjugated FITC imaging immunofluorescent confocal microscopy. Cytokeratin 8 (epithelial marker) Biotechnology. Kinase pS2 Gene Expression Assays—ERK PI3K assays liver 8Razandi Pedram Parks Biol. Chem.. 2003; 278: 2701-2712Google Immunoblots total AKT serve loading controls. RT-PCR exposed (control) to10 nm 24 h. Primers pS2, 5′-ATACCATCGACGTCCCTCCA AAGCGTGTCTGAGGTGTCCG control 5′-AGCCACATCGCTCAGAACAC GAGGCATTGCTGATGATCTTG. Tissue Blood Collection Histology—Prior ovariectomy, underwent daily vaginal lavage cytology, sequentially over several weeks. Organs under anesthesia just before euthanasia compliance studies approved Animal Care Research Development Committees Long Beach Veterans Affairs Medical Center. Dissected glands, ovaries, uteri/vaginal tissues embedded paraffin sectioning, stained hematoxylin eosin blood (400 μl) cardiac puncture during diestrus Vaginal Response E2—14-week-old ovariectomized, recovered week given 0.1 mg oil vehicle alone intraperitoneal injection 3 days. Twenty-four hours after final injection, attached anesthetized removed, fixed, paraffin-embedded, sectioned. deparaffinized cytokeratin 10 staining. staining immersed antigen retrieval solution microwaved monoclonal antibody, diluted 1/50 SuperBlock (Pierce) nonspecific IgG (DAKO), rinsed phosphate-buffered saline (Dulbecco's saline; Sigma). secondary (FITC-conjugated) 2 h room temperature observed fluorescent Nonspecific binding blocked Super Block (Pierce). marker E2-induced differentiation epithelia. Epithelial layer thickness also quantified. Body Composition Determinations—Four group (MOER, ERαKO, WT mice) imaged Magnetic Resonance, 4.0 Tesla magnet Surrey Imaging console. data consists three images mouse, constitute Dixon few modifications, generating water images. There 54 slices taken animal, slice mm thick. processing, assigned threshold remove artifacts around animal may contaminate calculation composition. value chosen individually, but most animals ∼10% maximum voxel value. Each image normalized values, respectively, compensate differences intensities between values summed entire set give amount water. numbers divided sum percentage, percentage one minus percentage. distribution abdominal, retroperitoneal, subcutaneous examined clear differences. Abdominal cut weighed comparison groups. Consumption pellets grams 4-week period measured four group, means ± S.D. variance plus Schefe's test, p < 0.05 significant Construction Validation Mouse—The targeting contains cytomegalovirus promoter (Fig. Transfecting null resulted strictly localization rapid kinase biological Additionally, engaging endogenous, breast cancer (8Razandi founder (supplemental S1A). Scholar), other. created background initially (Ref. Scholar "Experimental Procedures") validate model, established. organ intact Hepatocytes revealed membrane-localized protein, intracellular 1B). contrast, anywhere cell, whereas abundant nucleus membrane. ERβ (data shown). Functionally, PI3 occurred 1C, top panels). are establish (and specifically domain) supports E2. endogenous regulated element promoter. Only significantly 1C). Because required activation, lack bottom We assayed target Although there expected variability, widespread assessed 1D, left included ovary, brain, depots. Transgene quantified right panel). Strong lung, heart, retroperitoneal fat. It must appreciated, however, although relatively low, sufficient Fertility Female Reproductive Tract Function—Fourteen-week-old (n = 6) mated breeders. matings, resulted. reason infertility became apparent when tracts examined. uteri vaginas atrophic 2A). known infertile, part Atrophy 2C). had ovaries (but N terminus) tissue; mainly ERα, demonstrated 2B). whether epithelial targets action. 2C, predominantly uterine surface marker. exclusively (overlap 8). Some adjacent stroma present. Both comparably 2D). luteum suggested did ovulate undergo estrous cycling, sequential smears S1B). After neither 2E). ovariectomized injections robust 2E supplemental S1C). Feedback Prolactin Secretion Is Compromised—WT appropriate suppression FSH physiological inhibin production (Table 1). increase gonadotropins ovariectomy. However, nonovariectomized estradiol failed suppress LH. indicates negative feedback hypothalamic-pituitary gonadotrope axis impaired increased, consistent loss production.TABLE 1Adult levelsMiceLHFSHE2ProlactinInsulin-like 1Growth hormoneng/mlng/mlpg/mlng/mlng/mlng/mlWT0.8 0.16.8 0.536.2 1.953 4.3119 6.867 2.5WT (ovx)5.8 1.0ap versus MOER.33.4 2.50.2 0.119 2.6bp ovx.111 3.665 3.2ERαKO4.4 0.7ap MOER.5.4 0.9297 12cp test.23 2.9105 7.052 3.6ERαKO (ovx)5.2 0.618.7 1.9ND21 2.199 4.848 3.6MOER5.0 0.8ap MOER.6.1 1.0178 3.5cp test.25 2.8113 7.852 2.8MOER (ovx)4.7 0.616.3 2.1ND20 3.2101 251 3.1a MOER.b ovx.c test. Open table new tab Insulin-like statistically groups unaffected pituitary-derived rodents, occurs (9Scully K.M. Gleiberman A.S. Lubahn Rosenfeld M.G. 1997; 11: 674-681Google our ovariectomy 50% decrease prolactin. Basal secretion decreased further seen. suggests up-regulation maldevelopment glands genetic reflect lower collaborates respect. Rudimentary Mammary Gland Mice—ERαKO reported little (3Bocchinfuso determine can rescue phenotype, whole mounts 12-week-old those prominent overlapping S1D). Endogenous S1D), within genetically modified 3). ductal elongation severely retarded terminal end buds small scant lobuloalveolar epithelium side branching pubertal, virgin conditional impairs pregnancy (10Feng Y. Manka D. Wagner K.U. Khan S.A. 2007; 14718-14723Google Our indicate gland. Mice Develop Extensive Fat Deposition—Women menopause often develop obesity reversed administration (11Pedersen S.B. Bruun J.M. Hube F. Kristensen Hauner H. Richelsen B. Cell. 182: 27-37Google KO gene-deleted truncal (12Heine P.A. Taylor Iwamoto G.A. Cooke P.S. 97: 12729-12734Google 13Jones M.E. Thorburn A.W. Britt K.L. K.N. Wreford N.G. Proietto Oz O.K. Leury B.J. Robertson Yao Simpson 12735-12740Google therefore content models, extensive deposition 8-fold greater than 4). almost 60% Retroperitoneal S2) much more comparable. composition magnetic resonance 2). less intake per group). consumed 50 (mean S.D.), 2, 51 chow pellets/mouse, similar intakes, gained 6.5 0.9, 7.8 weight, 1.5 0.3 (*, test). suggest prevent excessive throughout body, contributes gain. Excessive post-menopausal women morbidity cardiovascular disease (14Quyyumi Scholar).TABLE 2Total 16-week-old miceMiceFatWaterp value%%MOER45.4 2.3ap mouse.54.6 3.4bp mouse.p 0.05ERαKO47.1 3.3ap mouse.52.9 4.1+p 0.05WT28.3 1.471.7 4.6a mouse.b Chappel regulation deposition. models depletion. unknown. clearest date phenotype investigated here insufficient regard. here. example, fat, abnormalities. very evident moderate expression. be, integration phenotype. question arises recapitulates First, published express 66kDa transfected respond transduction Further, A/B, C, activated expression: prevented (15Razandi Alton G. Ghonshani Webb Biol.. 23: 1633-1646Google Second, find cascades stimulated which responsible transduction. chronic involve transcription genes coding kinases, phosphatases, modulating proteins. novel finding A recently (NERKI) began mechanism Knocking mutation DNA-binding rodent lacked classical, ERE-mediated allele, yet preserved nonclassical (tethering) mediated (16Jakacka Ito Martinson Ishikawa Lee E.J. Jameson J.L. 2002; 16: 2188-2201Google NERKI hyperplastic uteri, hypoplastic complex interaction mechanisms leads organ. Heterozygous structures puberty, their demonstrate large luteum. why such considering fertile luminal present heterozygote/ERαKO heterozygote (17O'Brien J.E. Peterson T.J. Tong M.H. E.-J. Pfaff L.E. Weiss 281: 26683-26692Google findings some responses independently transcription. One explanation nongenomic hormone. Regarding membrane-initiated signaling, proposed modulate (18Vasudevan N. Kow L.M. D.W. 98: 12267-12271Google ERE promoters compromise integrated transcriptional involving include phosphorylation recruitment co-activators enhancing ERE-regulated (19Bjornstrom Sjoberg 833-842Google Possibly, tethering. E207A/G208A native MCF-7 Kousteni et al. (20Kousteni Almeida 27: 1516-1530Google vertebrae heterozygote/ERα appears mutation, plausible tethering-mediated Alternatively, ERα-initiated could mediate aspects begins sort itself requirement (21Sinkevicius K.W. Burdette Woloszyn Hamilton Sugg S.L. Temple K.A. Wondisford F.E. Woodruff T.K. Greene G.L. 2008; 149: 2970-2979Google summary, does tract, pituitary secretion, selective described. From results, conclude critical development, differentiation, Download .pdf (2.25 MB) Help pdf files