Regulation of hepatic fatty acid elongase and desaturase expression in diabetes and obesity

• DOI: 10.1194/jlr.m600177-jlr200
• Publication Date: 2006-06-22T01:12:02Z
• Authors: Yun Wang; Daniela Botolin; Jinghua Xu; Barbara Christian; Ernestine Mitchell; Bolleddula Jayapr...; Muraleedharan Nair; Jeffery M. Peters; Julia Busik; L. Karl Olson; Donald B. Jump
• Keywords: Liver X receptor; Stearoyl-CoA Desaturase; Small heterodimer partner

Fatty acid elongases and desaturases play an important role in hepatic whole body lipid composition. We examined the that key transcription factors played control of elongase desaturase expression. Studies with peroxisome proliferator-activated receptor α (PPARα)-deficient mice establish PPARα was required for WY14643-mediated induction fatty elongase-5 (Elovl-5), Elovl-6, all three [Δ5 (Δ5D), Δ6D, Δ9D]. Increased nuclear sterol-regulatory element binding protein-1 (SREBP-1) correlated enhanced expression Δ5D, Δ9D. Only Δ9D also regulated independently by liver X (LXR) agonist. Glucose l-type pyruvate kinase, Δ9D, Elovl-6 carbohydrate-regulatory protein/MAX-like factor (ChREBP/MLX) heterodimer. Suppression livers streptozotocin-induced diabetic rats high fat-fed glucose-intolerant low levels SREBP-1. In leptin-deficient obese (Lepob/ob), increased SREBP-1 MLX content Elovl-5, massive accumulation monounsaturated acids (18:1,n-7 18:1,n-9) neutral lipids. Diabetes- obesity-induced changes composition conclusion, these studies a PPARα, LXR, SREBP-1, ChREBP, ErrataJournal Lipid ResearchVol. 47Issue 10PreviewIn article “Regulation diabetes obesity”, published September 2006 issue Journal Research (Volume 47, pages 2028-2041), author affiliation lines contained errors. The correct names affiliations this should read: Full-Text PDF Open Access plays central metabolism. are synthesized de novo from glucose. This pathway uses products glycolysis and, along two enzymes acetyl-coenzyme A carboxylase (ACC) synthase, generates palmitate (16:0). Insulin, triiodothyronine (T3), glucocorticoids, glucose induce, C20 PUFAs, glucagon, epinephrine suppress, lipogenesis (1Jump D.B. Clarke S.D. Regulation gene dietary fat..Annu. Rev. Nutr. 1999; 19: 63-90Crossref PubMed Scopus (549) Google Scholar, 2Jump regulation transcription..Crit. Clin. Lab. Sci. 2004; 41: 41-78Crossref (294) 3Hillgartner F.B. Salati L.M. Goodridge A.G. Physiological molecular mechanisms involved nutritional synthesis..Physiol. 1995; 75: 47-76Crossref (401) Scholar). modifies structure through metabolic pathways include desaturation, elongation, mono-oxidation, peroxisomal β-oxidation (chain shortening). Such modifications occur to generated as well derived diet. These particularly critical generation end PUFA synthesis. Arachidonic (20:4,n-6) docosahexaenoic (22:6,n-3) main C20–22 PUFAs accumulating membranes tissues (4Sprecher H. Metabolism highly unsaturated n-3 n-6 acids..Biochim. Biophys. Acta. 2000; 1486: 219-231Crossref (662) Together, maintenance membrane storage, precursors signaling molecules, such eicosanoids, acid-regulated (2Jump 5Pawar A. Xu J. Jerks E. Mangelsdorf D.J. Jump receptors (PPARα) HEK293 cells..J. Biol. Chem. 2002; 277: 39243-39250Abstract Full Text (63) 6Pawar Unsaturated rat primary hepatocytes..J. 2003; 278: 35931-35939Abstract (161) Of various known affect structure, physiological elongation remains poorly defined. predominant occurs endoplasmic reticulum malonyl-CoA acyl-CoA substrates addition carbons acids. Elongases condensing interact 3-keto reductase, dehydratase, trans-2,3-enoyl-CoA reductase elongate (7Leonard A.E. Pereira S.L. Sprecher Huang Y.S. Elongation long-chain acids..Prog. Res. 43: 36-54Crossref (435) 8Moon Y.A. Horton J.D. Identification mammalian reductases two-carbon acyl cascade..J. 7335-7343Abstract (181) 9Prasad M.R. Nagi M.N. Ghesquier D. Cook L. Cinti D.L. Evidence multiple microsomes catalyzing condensation saturated, polyunsaturated coenzyme A..J. 1986; 261: 8213-8217Abstract rate is determined activity (condensing enzyme) not or dehydratase. Seven distinct subtypes [fatty elongase-1 (Elovl-1) Elovl-7] present mouse, rat, human genomes (www.ensembl.org). Elovl-1 (Ssc1) (LCE, FACE, rElo2) saturated induced transgenic overexpressing (10Moon Shah N.A. Mohapatra S. Warrington J.A. long chain sterol regulatory element-binding proteins..J. 2001; 276: 45358-45366Abstract (278) 11Horton Anderson N.N. Park S.W. Brown M.S. Goldstein J.L. Combined analysis oligonucleotide microarray data knockout identifies direct SREBP target genes..Proc. Natl. Acad. USA. 100: 12027-12032Crossref (1097) 12Matsuzaka T. Shimano Yahagi N. Yoshikawa Amemiya-Kudo M. Hasty A.H. Okazaki Tamura Y. Iizuka Ohashi K. et al.Cloning characterization lipogenic enzyme SREBPs..J. 911-920Abstract Elovl-2 (Ssc2) whereas Elovl-5 (FAE1, Relo1, Helo1) broad substrate array, C16–22 13Inagaki Aki Fukuda Kawamoto Shigeta Ono Suzuki O. biosynthesis C18 acids..Biosci. Biotechnol. Biochem. 66: 613-621Crossref (73) likely endogenous synthesis [i.e., conversion essential linoleic (18:2,n-6) α-linolenic (18:3,n-3) arachidonic (22:6,n-3)] (11Horton Elovl-3 (Cig30, Elo3) Elovl-4 (Elo4) expressed skin (14Westerberg R. Tvrdik P. Unden A-B. Mansson J-E. Norlen Jakobsson Holleran W.H. Elias P.M. Asadi Flodby al.Role ELOVL3 length development hair function..J. 279: 5621-5629Abstract (149) Scholar) retina (15Lagali P.S. Liu Ambasudhan Kakuk L.E. Bernstein Seigel G.M. Wong P.W. Ayyagari Evolutionarily conserved ELOVL4 vertebrate retina..Invest. Ophthalmol. Vis. 44: 2841-2850Crossref (40) Scholar), respectively. Both array (⩽C26). brown adipose tissue after exposure animals cold (16Tvrdik Kozak L.P. Nedergaard Cannon B. Jacobsson Cig30, mouse member novel protein family, recruitment tissue..J. 1997; 272: 31738-31746Abstract (89) Elovl-7 has been characterized. recently reported on tissue-specific, nutritional, developmental (17Wang Botolin Christian Busik C. Tissue-specific, elongases..J. 2005; 46: 706-715Abstract (209) outcome those suggested might be controlled at least factors, report extends findings examining (LXR), (ChREBP), MAX-like (MLX) Our includes vivo determine whether obesity Overall, specific transcriptional networks Human obtained National Disease Interchange (Philadelphia, PA). All procedures use care laboratory research were approved University Committee Animal Use Care Michigan State University. Male Sprague-Dawley (200–250 g; Charles River Laboratories, Kalamazoo, MI) maintained Harlan-Teklad chow (No. 8640) water ad libitum. Rats injected intraperitoneally streptozotocin (7.5 mg/100 g weight) 3 ml 25% (18Jump Bell Lepar G. Hu Insulin rapidly induces S14 transcription..Mol. Endocrinol. 1990; 4: 1655-1660Crossref (39) Three weeks later, blood measured receiving no (control) (diabetic; ⩾ 120 mg/dl). Blood isoflurane-anesthetized using meter (Freestyle Flash; Thera Sense, Inc., Alameda, CA). Control euthanized (isoflurane anesthesia exsanguination) recovery (plasma) liver. C57BL/6 (Jackson Bar Harbor, ME), 2 months age, fed diets containing 10% lard (D12450B) 60% (D12492; Diets, Inc.) libitum 10 weeks. Four days before euthanasia, subjected tolerance test. Briefly, (2 g/kg ip). withdrawn tail vein treatment. hand-held Inc.). Mice isoflurane exsanguinated; recovered. Livers used RNA extraction. lean Drs. Romsos Claycomb (Department Food Science Nutrition, University). (C57BL/6J-Lepob/+) (C57BL/6J-Lepob/ob) (B6.V-Lep ob/J, No. 000632; Jackson Laboratories) diet RNA, lipid, Homozygous wild-type PPARα-deficient (PPARα−/−) Sv/129 genetic background (19Lee S.S. Pineau Drago Lee E.J. Owens J.W. Kroetz Fernandez-Salguero Westphal Gonzalez F.J. Targeted disruption alpha isoform results abolishment pleiotropic effects proliferators..Mol. Cell. 15: 3012-3022Crossref (1506) 20Akiyama T.E. Nicol C.J. Fievet Staels Ward J.M. Auwerx Peters Peroxisome receptor-α regulates homeostasis, but associated obesity: congenic lines..J. 39088-39093Abstract (117) either one WY14643 (at 50 500 mg/kg; Bio-Serv, Piscataway, NJ) 1 week. euthanized, removed, isolated (Charles Rat hepatocytes prepared Teklad chow-fed (ad libitum) male cultured BioCoat (type collagen) plates (Beckon Dickinson, Bedford, MA) (21Botolin Wang Docosahexaneoic [22:6, n-3] stimulates protein-1c (SREBP-1c) degradation Erk- 26S proteasome-dependent pathway..J. 2006; 47: 181-192Abstract (130) For extraction, cells plated onto 100 mm type collagen-coated (BD Bioscience, 107 cells/plate Williams E (Gibco/Invitrogen, Carlsbad CA), mM lactate, nM dexamethasone, μM insulin (Sigma, St. Louis, MO), fetal bovine serum (Gibco/Invitrogen). adenoviral infection studies, same medium six-well 1.5 × 106 cells/well. ratio culture cell number constant different plating conditions. treatments, incubated [Williams + dexamethasone without (0.17 U/ml) and/or 25 glucose]. Total extracted samples template quantitative real-time (qRT) PCR Northern described previously 22Xu l-pyruvate kinase promoter glucose, proliferator activated agonist..J. 281: 18351-18362Abstract Specific primers each (Table ) designed Primer Express software (Applied Biosystems, Foster City, First-strand cDNA SuperScript II RNase H reverse transcriptase (Invitrogen). Synthesized mixed 2× SYBR Green Master Mix Biosystems) sets gene-specific forward quantification ABI PRISM 7700 Sequence Detection System Biosystems). reactions performed triplicate. relative amounts mRNAs calculated comparative threshold cycle method (User Bulletin 2; Applied Cyclophilin control, normalized abundance cyclophilin mRNA. Primers qRT-PCR listed Table 1.TABLE 1Primers transcriptase-polymerase reactionGeneForwardReverseRatElovl-1CCCTACCTTTGGTGGAAGAATCCAGATGAGGTGGATGATGElovl-2TTTGGCTGTCTCATCTTCCAGGGAAACCGTTCTTCACTTCElovl-5TACCACCATGCCACTATGCTGACGTGGATGAAGCTGTTGAElovl-6CAACGGACCTGTCAGCAAGTGGTACCAGTGCAGGAAGAΔ5DTGGAGAGCAACTGGTTTGTGGTTGAAGGCTGACTGGTGAAΔ6DTGTCCACAAGTTTGTCATTGGACACGTGCAGGCTCTTTATGΔ9DACATTCAATCTCGGGAGAACACCATGCAGTCGATGAAGAACLXRαTCAGCATCTTCTCTGCAGACCGGTCATTAGCATCCGTGGGAACALXRβAAGCTGGTGAGCCTGCGCCGGCAGCTTCTTGTCCTGSterol-regulatory protein-1cGATTGCACATTTGAAGACATGCTTGTCCCAGGAAGGCTTCCAGAGAl-type kinaseAGGAGTCTTCCCCTTGCTCTACCTGTCACCACAATCACCACyclophilinCTTCTTGCTGGTCTTGCCATTCCTGGATGGCAAGCATGTGGTCTTTGβ-ActinACTATTGGCAACGAGCGGTTTGTCAGCAATGCCTGGGTACAMouseElovl-1CCCTACCTTTGGTGGAAGAAATCCAGATGAGGTGGATGATGElovl-2ACGCTGGTCATCCTGTTCTTGCCACAATTAAGTGGGCTTTElovl-5GGTGGCTGTTCTTCCAGATTCCCTTCAGGTGGTCTTTCCElovl-6ACAATGGACCTGTCAGCAAAGTACCAGTGCAGGAAGATCAGTΔ5DTGTGTGGGTGACACAGATGAGTTGAAGGCTGATTGGTGAAΔ6DCCACCGACATTTCCAACACGGGCAGGTATTTCAGCTTCTTΔ9DTCAACTTCACCACGTTCTTCACTCCCGTCTCCAGTTCTCTTCyclophilinCTTCTTGCTGGTCTTGCCATTCCTGGATGGCAAGCATGTGGTCTTTGβ-ActinGACGGCCAGGTCATCACTATCGGATGTCAACGTCACACTTHumanElovl-1GCTGGCTGAGCACCTATACCTCAGCTCAATGAACTTGGAGAAElovl-2CCCTTCGGTTGTCTCATCTTCAGGTGGCTCTTGCATATCTTElovl-5GTGCACATTCCCTCTTGGTTTGGTCCTTCAGGTGGTCTTTElovl-6CTAAGCAAAGCACCCGAACTGGCAACCATGTCTTTGTAGGAΔ5DTTGGCCTGGATGATTACCTTCTGTGTCACCCACACAAACCΔ6DATCCCTTTCTACGGCATCCTTAGGCCTCCTGGTCAATCTCΔ9DCACCCAGCTGTCAAAGAGAAGATGAAGCACATCATCAGCAA β-ActinCTCTTCCAGCCTTCCTTCCTTGTTGGCGTACAGGTCTTTGΔ5D, Δ5 desaturase; Elovl-1, elongase-1; receptor. table new tab chloroform-methanol (2:1) plus butylated hydroxytoluene 7-Nonadecenoic (19:1) added standard time Protein (Bio-Rad, Hercules, CA) extracts initial homogenization step. lipids saponified, fractionated, quantified reverse-phase HPLC YMC J-Sphere (ODS-H80) column gradient starting 77.5% acetonitrile acetic (0.1%) ending 100% over 90 min flow 1.0 ml/min Waters 600 controller. detected both ultraviolet light absorbance 192 nm (Waters model 2487) evaporative scatter 2420). structures confirmed Mass Spectrometry facility GC-MS (www.bch.msu.edu/facilities/massspec/index.html). standards Nu-Chek Prep (Elysian, MN). Liver microsomal 23Botolin Selective proteolytic processing SREBP-2 during postnatal development..J. 6959-6962Abstract (38) Proteins (50–100 μg) fractions separated electrophoretically SDS-PAGE (NuPAGE 4–12% polyacrylamide Bis-Tris; Invitrogen) transferred nitrocellulose membranes. Membranes antibodies (IgG-2A4, sc-13551; Santa Cruz Biotechnology, San Cruz, (IgG-7D4, monoclonal antibody). Hepatic factor-4 (HNF-4α; C-19), (N-17), anti-goat anti-rabbit Biotechnology. ChREBP antibody Novus Biologicals (Littleton, CO). Anti-mouse secondary Bio-Rad; SuperSignal West Pico chemiluminescence kit (Pierce) detection system used. Cloning Elovl-2, coding region transcript ligated into Ad-Easy XL vector (Stratagene), recombined BJ 5183 cells, propagated XL10 Gold ultracompetent cells. Ad-DNA packaged particles Ad-293 resulting adenovirus amplified Recombinant adenovirus-expressing dominant negative (Ad-dnMLX) doxycycline-inducible SREBP-1c (Ad-nSREBP-1) Towle (University Minnesota, Minneapolis, MN) (24Ma Tsatsos N.G. H.C. Direct ChREBP.Mlx regulating glucose-responsive genes..J. 280: 12019-12027Abstract (142) 25Stoeckman A.K. expression..J. 27029-27035Abstract Adenovirus Viral lysates titered Adeno-X Rapid Titer Kit (Clontech). Confluent infected (5–10 plaque-forming units/cell). Using Ad-green fluorescent infection, >80% functional 5–10 units/cell level. differential centrifugation (23Botolin carried out procedure Moon al. reaction mixtures μg proteins total volume μl. constituents follows: potassium phosphate buffer, pH 6.5, 5 rotenone (Sigma), 40 [Avanti Polar Lipids (Alabaster, AL) Sigma], 60 6.5 dpm/pmol [2-14C]malonyl-CoA (Perkin-Elmer), NADPH 20 BSA (fatty acid-free). Reactions 37°C) initiated NADPH. When substrate, NaOH-neutralized (40 μM) replaced acyl-CoA. Coenzyme (CoASH) (100 μM), MgCl2 (1 mM), ATP mM) generate Elongase terminated μl N KOH methanol; saponified h 65°C. saponification acidified HCl; ethanol aid hexane extraction Elongated collected independent extractions (800 μl). Hexane pooled, 14C radioactivity β-scintillation counting. Results units (nmol [14C]malonyl-CoA incorporated/mg protein/20 min). Formation dependent presence acid-CoA. verified flow-through counter (6Pawar Statistical Student's t-test ANOVA post hoc Tukey's honestly significant difference test (http://faculty.vassar.edu/lowry/VassarStats.html). first objective compare (Fig. 1A ). seven identified species, indicated only four liver: Elovl-6. Based mRNA abundance, hierarchy > = higher than assessed substrates. 16:0-CoA Elovl-6; 20:4-CoA Elovl-5; 24:0-CoA 18:0-CoA highest liver, 26:0-CoA comparable among species. 22:4-CoA lowest Differences can attributed subtype Mouse appear have capacity (Δ5D) Δ6D compared livers. reveal species differences Feeding agonist, WY14643, certain promotes plasma Here, we further evaluated effect PPARα−/− examined. mg WY14643/kg diet) week (500 mg/kg) (14- 3.6-fold, respectively). Previous established agonist (26Matsuzaka Osuga al.Dual Δ5- Δ6-desaturase PPARalpha..J. 107-114Abstract indi