A5004342890- RNA and protein synthesis mechanisms
- RNA modifications and cancer
- Advanced biosensing and bioanalysis techniques
- RNA Research and Splicing
- Genomics and Phylogenetic Studies
- Molecular Biology Techniques and Applications
- DNA and Nucleic Acid Chemistry
- Telomeres, Telomerase, and Senescence
- Bacteriophages and microbial interactions
- Bacterial Genetics and Biotechnology
- RNA Interference and Gene Delivery
- Gene expression and cancer classification
- Cancer Research and Treatments
- Plant Virus Research Studies
- Peptidase Inhibition and Analysis
- Chemical Synthesis and Analysis
- Biochemical and Molecular Research
- Microplastics and Plastic Pollution
- Urinary Tract Infections Management
- Animal Genetics and Reproduction
- Renal Diseases and Glomerulopathies
- Photosynthetic Processes and Mechanisms
- DNA Repair Mechanisms
- Plant Disease Resistance and Genetics
- Monoclonal and Polyclonal Antibodies Research
AmpTec (Germany)
2008-2014
Safdarjang Hospital
2006
Indian Council of Medical Research
2006
Artes Biotechnology (Germany)
2004
Kiel University
1992-2003
Bayer (United States)
1987
Yale University
1985-1987
Whitehead Institute for Biomedical Research
1986
Osaka University
1986
Heidelberg University
1986
The complete nucleotide sequence of citrus exocortis viroid (CEV, propagated in Gymura) and chrysanthemum stunt (CSV, Cineraria) has been established, using labelling vitro direct RNA sequencing methods a new screening procedure for the rapid selection suitable fragments from limited digests. covalently closed circular single-stranded RNAs consist 371 (CEV) 354 (CSV) nucleotides, respectively. As previously shown potato spindle tuber (PSTV, 359 nucleotides), CEV CSV also contain long...
Human somatic cells have essentially no telomerase activity. Telomerase is linked to tumor genesis and a valuable marker for malignant growth. Extreme paucity of the enzyme neccessitated development PCR-based assay, 'telomeric repeat amplification protocol' (TRAP). Unfortunately, this method not without difficulties. Amplification products are related size amplified products. Furthermore, false positive results can occur, careful control reaction conditions crucial. We analyzed in detail...
Mammals have high growth rates in embryonic and juvenile phases no adult senescent phases. We analyzed telomerase activity a fundamentally different animal which grows indeterminately. Lobsters ( Homarus americanus ) grow throughout their life the occurrence of senescence is slow. A modified TRAP assay was developed lobster telomeric repeat sequence TTAGG determined. detected activities were dependent on RNA protein components, required dGTP, dATP dTTP, but not dCTP. Telomerase products with...
Using end-labelled RNA, significant changes in base specificity of three nucleases have been detected under defined conditions. Staphylococcus aureus nuclease at pH 3.5 without Ca ++ cleaves all Pyr-N bonds more uniformly and efficiently than RNase A, any preference for Pyr-A bonds. At 7.5 10 mM this enzyme N-C N-G slowly, whereas N-U N-A are hydrolyzed rapidly. Hence, the 3′- or 5′-side a phosphodiester bond can determine S. nuclease. - In absence urea, Neurospora crassa endonuclease bonds,...
Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences the RNase T1 A fingerprints. The complete sequencing isolate comparison its primary structure with previously established one pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, AAAAAAGGAC ‘severe’ are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, AAGGAC 'mild' strain. Thus, three nucleotide...
The application of global gene expression profiling to saliva samples is hampered by the presence partially fragmented and degraded RNAs that are difficult amplify detect with prevailing technologies. Moreover, often limited volume a challenge quantitative PCR (qPCR) validation multiple candidates. aim this study was provide proof-of-concept data on combination universal mRNA-amplification method exon arrays for candidate selection multiplex preamplification easy validation.We used...
Journal Article Enzymatic synthesis of 2′-modified nucleic acids: identification important phosphate and ribose moieties in RNase P substrates Get access Frank Conrad, Conrad Institut für Allgemeine Mikrobiologie der Christian-Albrechts-UniversitätAm Botanischen Garten 9, D-24118 Kiel, Germany Search for other works by this author on: Oxford Academic PubMed Google Scholar Andreas Hanne, Hanne Rajesh K. Gaur, Gaur +Present address: Howard Hughes Medical Institute, University Massachusetts...
Journal Article The nucleotide sequence of the 5S rRNA from archaebacterium Thermoplasma acidophilum Get access Kenneth R. Luehrsen, Luehrsen *Department Biophysical Sciences, University HoustonHouston, TX 77004, USA Search for other works by this author on: Oxford Academic PubMed Google Scholar George E. Fox, Fox Michael W. Kilpatrick, Kilpatrick **Chemistry Department, Birmingham UniversityBirmingham B15 2TT, UK Richard T. Walker, Walker Horst Domdey, Domdey $Max Planck Institut für...
Abstract Background It has been shown previously that aminocoumarin antibiotics such as novobiocin lead to immediate downregulation of recA expression and thereby inhibit the SOS response, mutation frequency recombination capacity in Staphylococcus aureus . Aminocoumarins function by inhibiting ATPase activity DNA gyrase subunit B with a severe impact on supercoiling. Results Here, we have analysed global relaxing agent gene S. Using novobiocin-resistant mutant, it became evident change is...
Efficient transcription reactions of DNA-dependent RNA polymerases require the presence a specific promoter sequence. This report shows that in absence their cognate promoter, two bacteriophage are capable performing unusual reactions: (i) DNA template serves also as primer for synthesis and this leads to hybrid DNA/RNA molecules, (ii) if forms hairpin structure, linear can be transcribed via 'rolling circle' mechanism.
In established methods for analyzing ribozyme kinetics, radiolabeled RNA substrates are primarily used. Each data point requires the cumbersome sampling, gel electrophoretic separation, and quantitation of reaction products, apart from continuous loss substrate by radioactive decay. We have used stable, double fluorescent end-labeled substrates. Fluorescence one fluorophore is quenched intramolecular energy transfer (FRET). Upon cleavage, both dyes become separated in two products...
The early response gene IEX‐1 modulates apoptosis and cell growth in a poorly defined fashion. Here, we describe the effect of hammerhead ribozymes specifically disrupting expression 293 cells. Compared to vector control, cells exhibit reduced rate slowed cycle progression, when stably transfected with concatemeric ribozyme construct. In addition, these were much less sensitive induced by an activating Fas/CD95 antibody or anti‐cancer drugs etoposide doxorubicin. By modulating cycle, might...