A5089046063- Advanced biosensing and bioanalysis techniques
- Electrochemical sensors and biosensors
- Advanced Nanomaterials in Catalysis
- Electrochemical Analysis and Applications
- Biosensors and Analytical Detection
- Monoclonal and Polyclonal Antibodies Research
- Conducting polymers and applications
- Food Allergy and Anaphylaxis Research
- Gas Sensing Nanomaterials and Sensors
- Mycotoxins in Agriculture and Food
- Marine and coastal ecosystems
- Advanced battery technologies research
- SARS-CoV-2 detection and testing
- 2D Materials and Applications
- TiO2 Photocatalysis and Solar Cells
- Nanoparticles: synthesis and applications
- Plant responses to water stress
- MXene and MAX Phase Materials
- Advanced Memory and Neural Computing
- Magnesium Oxide Properties and Applications
- Celiac Disease Research and Management
- Transition Metal Oxide Nanomaterials
- Microplastics and Plastic Pollution
- Soybean genetics and cultivation
- Molecular Sensors and Ion Detection
North-West University
2022-2025
University of the Western Cape
2014-2021
Universiti Sains Malaysia
2017
MXenes, a two-dimensional transition metal carbide, nitride, and carbonitride family, have received lot of interest in recent years due to their unique properties diverse applications. This review presents comprehensive analysis the applications electrochemical characteristics providing nuanced viewpoint on potential impact various fields. MXenes large surface area, high electrical conductivity, variable chemistry, making them appealing candidates for energy storage, catalysis, sensing,...
A sensitive and reagentless electrochemical aptatoxisensor was developed on cobalt (II) salicylaldiimine metallodendrimer (SDD–Co(II)) doped with electro-synthesized silver nanoparticles (AgNPs) for microcystin-LR (L, l-leucine; R, l-arginine), or MC-LR, detection in the nanomolar range. The GCE|SDD–Co(II)|AgNPs fabricated 5’ thiolated aptamer through self-assembly modified surface of glassy carbon electrode (GCE) electronic response measured using cyclic voltammetry (CV). Specific binding...
Abstract ZnO and TiO 2 nanoparticles were prepared through a plant-extract mediated hydrothermal synthesis. X-ray diffraction (XRD) study confirmed the crystalline nature phase characteristic of obtained nanoparticles. profile analysis models such as Williamson–Hall analysis, size-strain plot Rietveld further used in evaluating microstructural parameters materials. The calculated particle size for all was great agreement, with values range 55.46–87.6 nm recorded ZnO, while , crystallite...
Zinc cobaltite (ZnCo2O4) is a ternary metal oxide found in spinel with promising properties for various applications. Optimizing its catalytic activity requires an understanding of electrochemical behavior. The ZnCo2O4 have significantly improved due to recent developments nanostructuring, doping, surface modification, hybridization, structural engineering, and activation. These improvements inspired motivated researchers by presenting the latest field. structure, coupled redox cobalt ions,...
An impedimetric immunosensor for fumonisin B₁ (FB₁) was developed from a poly(2,5-dimethoxyaniline)-multi-walled carbon nanotube (PDMA-MWCNT) composite on the surface of glassy electrode (GCE). The prepared electrochemically and characterized using cyclic voltammetry. preparation FB₁ involved drop-coating bovine serum albumin mixture anti-fumonisin antibody (anti-Fms) onto polymer-modified GCE. electrochemical impedance spectroscopy (EIS) responses (GCE/PDMA-MWCNT/anti-Fms) have linear range...
Transglutaminase is primarily involved with activation and progression of coeliac disease through the ingestion gluten which initiates production antibodies against transglutaminase. This results in damage small intestine reducing diffusion digested foods into blood vessels. The diagnosis can be done by measurement work involves development an electrochemical immunosensor for detection anti-transglutaminase antibodies. A platinum modified polypyrrole-cobalt (II) salicyladiimine...
17β-estradiol (E2) is an important natural female hormone that also classified as estrogenic endocrine-disrupting compound (e-EDC). It is, however, known to cause more damaging health effects compared other e-EDCs. Environmental water systems are commonly contaminated with E2 originates from domestic effluents. The determination of the level thus very crucial in both wastewater treatment and aspect environmental pollution management. In this work, inherent strong affinity estrogen receptor-α...
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0) on glassy carbon (GCE), i.e., (GCE/PDMA–PVS–Ag0) was used in the biosensor development....
Abstract Rhodamine B (RhB)'s photocatalytic activity was enhanced through the green chemical synthesis of metal oxide nanoparticles (ZnO and TiO 2 ). To produce nanoparticles, zinc nitrate hexahydrate titanium tetra-isopropoxide precursors were hydrothermally generated using extracts from Vachellia hebeclada . These synthesised then calcined at high temperatures. Variations in several parameters, including their effects on crystal size morphological properties investigated scanning electron...