Mona Mahfood

ORCID: 0000-0003-0455-4388
Publications
Citations
Views
---
Saved
---
About
Contact & Profiles
Research Areas
  • Hearing, Cochlea, Tinnitus, Genetics
  • Vestibular and auditory disorders
  • Connexins and lens biology
  • Cancer-related molecular mechanisms research
  • MicroRNA in disease regulation
  • Ear Surgery and Otitis Media
  • Sexual Differentiation and Disorders
  • RNA regulation and disease
  • RNA modifications and cancer
  • Genomics and Rare Diseases
  • Hypothalamic control of reproductive hormones
  • RNA and protein synthesis mechanisms
  • Dermatologic Treatments and Research
  • Plant Reproductive Biology
  • IL-33, ST2, and ILC Pathways
  • Wnt/β-catenin signaling in development and cancer
  • Barrier Structure and Function Studies
  • Genetic and Clinical Aspects of Sex Determination and Chromosomal Abnormalities
  • Growth Hormone and Insulin-like Growth Factors
  • Mycobacterium research and diagnosis
  • Inflammatory mediators and NSAID effects
  • Pancreatic function and diabetes
  • Metabolism and Genetic Disorders
  • Metabolism, Diabetes, and Cancer
  • Ovarian function and disorders

University of Sharjah
2017-2025

The brain endothelial barrier permeability is governed by tight and adherens junction protein complexes that restrict paracellular at the blood-brain (BBB). Dysfunction of inter-endothelial junctions has been implicated in neurological disorders such as multiple sclerosis, stroke Alzheimer's disease. molecular mechanisms underlying junctional dysfunction during BBB impairment remain elusive. MicroRNAs (miRNAs) have emerged versatile regulators function under physiological pathological...

10.1371/journal.pone.0262152 article EN cc-by PLoS ONE 2022-01-13

Background/Objectives: RNA-modifying proteins play a crucial role in the progression of cancer. The fat mass and obesity-associated protein (FTO) alkB homolog 5 RNA demethylase (ALKBH5) are RNA-demethylating that have contrasting effects renal cell carcinoma (RCC) among different populations. This research investigates genotype expression levels FTO ALKBH5 RCC patients from Middle East Northern Africa (MENA) region. Methods: Formalin-fixed paraffin-embedded samples kidney biopsies controls...

10.3390/cancers17091395 article EN Cancers 2025-04-22

Tuning the nanostructural properties of silver nanoparticles for optimised surface enhanced Raman scattering sensing SARS CoV-2 spike protein, Kais Daoudi, Krithikadevi Ramachandran, Soumya Columbus, Abdelaziz Tlili, Mona Mahfood, My Ali El Khakani, Mounir Gaidi

10.1088/2043-6262/ac2745 article EN other-oa Advances in Natural Sciences Nanoscience and Nanotechnology 2021-09-01

Aim: Mutations in the gap junction protein beta 2 (GJB2) gene are responsible for more cases of nonsyndromic recessive hearing loss than any other gene. The purpose our study was to evaluate prevalence GJB2 mutations among affected individuals from United Arab Emirates (UAE). Methods: There were 50 diagnosed with hereditary and 120 healthy enrolled study. Sanger sequencing method used screen coding region all individuals. c.-1G>A variant determined by polymerase chain reaction-restriction...

10.1089/gtmb.2017.0130 article EN Genetic Testing and Molecular Biomarkers 2017-10-10

Background: Most breast cancer-related deaths result from metastasis. Understanding the molecular basis of metastasis is needed for development effective targeted and preventive strategies. Matrix metalloproteinase-1 (MMP1) plays an important role in brain (BM) triple-negative cancer (TNBC) by promoting extravasation cells across endothelium (BE). MMP1 expression controlled endogenous microRNAs. Preliminary bioinformatics analysis has revealed that miR-623, known to target 3ʹUTR MMP1,...

10.2147/bctt.s372083 article EN cc-by-nc Breast Cancer Targets and Therapy 2022-08-01

Abstract Background Hearing loss is a rare hereditary deficit that rather common among consanguineous populations. Autosomal recessive non-syndromic hearing the predominant form of worldwide. Although prevalent, extremely heterogeneous and poses pitfall in terms diagnosis screening. Using next-generation sequencing has enabled rapid increase identification rate genes variants conditions, including loss. We aimed to identify causative two Yemeni families affected with using targeted (clinical...

10.1186/s40246-023-00489-1 article EN cc-by Human Genomics 2023-05-15

Hereditary hearing loss is a rare hereditary condition that has significant presence in consanguineous populations. Despite its prevalence, marked by substantial genetic diversity, which poses challenges for diagnosis and screening, particularly cases with no clear family history or when the impact of variant requires functional analysis, such as case missense mutations UTR variants. The advent next-generation sequencing (NGS) transformed identification genes variants linked to various...

10.1186/s40246-024-00630-8 article EN cc-by Human Genomics 2024-06-07

The development of next generation sequencing techniques has facilitated the detection mutations at an unprecedented rate. These efficient tools have been particularly beneficial for extremely heterogeneous disorders such as autosomal recessive non-syndromic hearing loss, most common form genetic deafness. GJB2 are cause hereditary loss. Amongst them NM_004004.5: c.506G > A (p.Cys169Tyr) mutation associated with varying severity loss unclear segregation patterns. In this study, we report a...

10.1016/j.sjbs.2021.04.036 article EN cc-by-nc-nd Saudi Journal of Biological Sciences 2021-04-21

Autosomal recessive non-syndromic hearing loss is one of the most common monogenic diseases. It characterized by high allelic and locus heterogeneities that make a precise diagnosis difficult. In this study, whole-exome sequencing was performed for an affected patient allowing us to identify new frameshift mutation (c.804delG) in Immunoglobulin-Like Domain containing Receptor-1 (ILDR1) gene. Direct Sanger segregation analysis were family pedigree. The homozygous all siblings but heterozygous...

10.1371/journal.pone.0185281 article EN cc-by PLoS ONE 2017-09-25

Abstract Palmoplantar keratoderma (PPK) is a heterogenous group of skin disorders characterized by persistent thickening the palms hands and sometimes soles feet. PPK can be classified into many types, including diffuse, transgradient, focal or striate, where areas palmoplantar are alternatively thickened. Mutations in four main genes, keratin 9 ( KRT9 ), 1 KRT1 desmoglein DSG1 desmoplakin DSP have been associated with PPK. Striate (SPPK) commonly caused mutations . However, gene identified...

10.1111/ahg.12335 article EN Annals of Human Genetics 2019-06-13

Autosomal recessive nonsyndromic hearing loss (ARNSHL) is the most common form of hereditary deafness. Despite its frequency, diagnosis this disorder continues to be a challenging task given extreme genetic heterogeneity. The purpose study was identify causative mutation in consanguineous United Arab Emirates (UAE) family with ARNSHL.Clinical exome sequencing (CES) followed by segregation analysis via Sanger used mutation. In addition, 109 deaf individuals and 50 deafness-free controls from...

10.1089/gtmb.2018.0264 article EN Genetic Testing and Molecular Biomarkers 2019-02-13

Non-syndromic hearing loss (NSHL) is a hereditary disorder that affects many populations. Many genes are involved in NSHL and the mutational load of these often differs among ethnic groups. Claudin-14 (CLDN14), tight junction protein, known to be associated with In this study, we aimed identify responsible variants 3 different Yemeni families affected NSHL. Firstly, clinical exome sequencing (CES) performed for patients from identified new nonsense variant (c.414G > A) CLDN14. This was then...

10.3389/fgene.2019.01087 article EN cc-by Frontiers in Genetics 2019-11-07

In order to determine the consequence of ILDR1 reported mutations on splicing and translation initiation, we used Human Splicing Finder (version 3.0) (http://www.umd.be/HSF3/) ORF finder (http://www.geneinfinity.org/sms/sms_orffinder.html) respectively.

10.17504/protocols.io.jhxcj7n preprint EN 2017-08-21

Sanger sequencing was performed on available samples from all affected family members to determine whether the potential mutation in causative gene co-segregated with disease phenotype. In order amplify exon 7 of ILDR1 gene, we designed following primers: ILDR1-7F: TTGATGTCCTGATTCTGAGG and ILDR1-7R: CTCTGTGGTGGAATGAGAGG. The amplified products were then purified using Wizard SV Gel PCR Clean-up system (Promega, USA) consequently sequenced BigDye Terminator v3.1 Cycle Sequencing Kit (Applied...

10.17504/protocols.io.jhvcj66 preprint EN 2017-08-21

The novel c.804delG mutation, occurring in the seventh exon of ILDR1 gene, abolishes a FauI restriction site. pattern exon7 fragment (1003 bp) was used to screen 50 deaf individuals and 120 unrelated healthy UAE individuals. Digestion PCR products performed according manufacturer’s instructions (New England Biolabs, USA), followed by separation on 2% agarose gels.

10.17504/protocols.io.jhwcj7e preprint EN 2017-08-21

Sequencing library construction, exome capture, sequencing, and standard data analyses for the affected children in this family was performed bySengenics. Exome capturing enrichment carried out using SureSelect All ExonV5kit (Agilent Technologies, Santa Clara, CA, USA) following manufacturers' protocols. Whole sequencing on Illumina HiSeq2500system (Illumina, San Diego, USA). Paired end (2×100 bases) DNA sequence reads that passed quality control i.e phred score > 20 were mapped to human...

10.17504/protocols.io.jhscj6e preprint EN 2017-08-21
Coming Soon ...