A5083221156- DNA and Nucleic Acid Chemistry
- Advanced biosensing and bioanalysis techniques
- RNA Interference and Gene Delivery
- RNA and protein synthesis mechanisms
- Genomics and Chromatin Dynamics
- Nanocluster Synthesis and Applications
- Advanced Nanomaterials in Catalysis
- Teaching and Learning Programming
- Italian Literature and Culture
- Mast cells and histamine
- Plant Genetic and Mutation Studies
- Scheduling and Optimization Algorithms
- Urban Planning and Valuation
- Cancer therapeutics and mechanisms
- Metal complexes synthesis and properties
- Bacteriophages and microbial interactions
- Interactive and Immersive Displays
- Viral Infections and Outbreaks Research
- Immunodeficiency and Autoimmune Disorders
- HIV Research and Treatment
- Augmented Reality Applications
- Diverse academic and cultural studies
- Epigenetics and DNA Methylation
- Mosquito-borne diseases and control
University of Padua
2015-2024
Central European Institute of Technology
2022-2024
Central European Institute of Technology – Masaryk University
2022-2024
Central European Institute of Technology
2023
National Institute of Chemistry
2023
Inserm
2023
Masaryk University
2023
École Polytechnique
2023
Centre National de la Recherche Scientifique
2023
Slovak Academy of Sciences
2023
Abstract I-Motifs (iM) are non-canonical DNA structures potentially forming in the accessible, single-stranded, cytosine-rich genomic regions with regulatory roles. Chromatin, protein interactions, and intracellular properties seem to govern iM formation at sites i-motif propensity (iMFPS) human cells, yet their specific contributions remain unclear. Using in-cell NMR oligonucleotide iMFPS models, we monitor iM-associated structural equilibria asynchronous cell cycle-synchronized HeLa cells...
In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 kit2 have studied depth, little information is available on folding behavior despite its key role regulation transcription. Notably, contains consensus sites for SP1 AP2 transcription factors. Herein, a set complementary spectroscopic biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts...
EGFR is an oncogene which codifies for a tyrosine kinase receptor that represents important target anticancer therapy. Indeed, several human cancers showed upregulation of the activity this protein. The promoter gene contains some G-rich domains, thus representing yet unexplored point intervention to potentially silence gene. Here, we explore conformational equilibria 30-nt long sequence located at position -272 (EGFR-272). By merging spectroscopic and electrophoretic analysis performed on...
Similarly to enzymes, functionalized gold nanoparticles efficiently catalyze chemical reactions, hence the term nanozymes. Herein, we present our results showing how surface-passivated behave as synthetic nanonucleases, able cleave pBR322 plasmid DNA with highest efficiency reported so far for catalysts based on a single metal ion mechanism. Experimental and computational data indicate that have been successful in creating catalytic site precisely mimicking suggested natural metallonucleases...
The proximal promoter of c-KIT contains a peculiar domain that consists three short G-rich sequences are close together and can fold into noncanonical DNA secondary structures called G-quadruplexes (G4). Here, we focused on sequence containing two consecutive G4 (kit2 kit*). By electrophoretic, surface plasmon resonance, spectroscopic techniques, demonstrated they retain the ability to upon being inserted extended sequence. highlighted occurrence crosstalk between forming units. This...
The regulation of conformational arrangements gene promoters is a physiological mechanism that has been associated with the fine control expression. Indeed, it can drive time and location for selective recruitment proteins transcriptional machinery. Here, we address this issue at KIT proximal promoter where three G-quadruplex forming sites are present (kit1, kit2 kit*). On model, focused on interplay between (G4) formation SP1 recruitment. By site directed mutagenesis, prepared library...
G-quadruplexes (G4) within oncogene promoters are considered to be promising anticancer targets. However, often they undergo complex structural rearrangements that preclude a precise description of the optimal target. Moreover, even when solved structures available, refer thermodynamically stable forms but little or no information is supplied about their multistep folding pathway. To shed light on this issue, we systematically followed kinetic behavior G-rich sequence located c-KIT proximal...
The interactions of three representative gold(III) complexes with human telomeric DNA sequences were analysed using a variety biophysical methods, including melting, circular dichroism, SPR and ESI MS; remarkable highlighted for all tested complexes, although they associated to significantly different binding profiles. most interesting compound was Auoxo6, dinuclear complex, which beyond manifesting conspicuous affinity the G-quadruplex conformation, turned out be very effective in inducing...
G-quadruplexes, alternative DNA secondary structures present in telomeres, emerge as promising targets for the treatment of cancer, because they prevent telomere elongation and accordingly cell proliferation. Within this study, theoretically validated pharmacophore- shape-based models well a docking protocol were generated applied parallel virtual screening identification novel G-quadruplex ligands. Top-ranked hits retrieved with all methods independently addition consensus approach selected...
Abstract EGFR is an oncogene that encodes for a trans-membrane tyrosine kinase receptor. Its mis-regulation associated to several human cancers that, consistently, can be treated by selective inhibitors. The proximal promoter of contains G-rich domain located at 272 bases upstream the transcription start site. We previously proved it folds into two main interchanging G-quadruplex structures, one parallel and hybrid topology. Here we present first evidences supporting ability complementary...
G-quadruplexes (G4s) are tetrahelical DNA structures stabilized by four guanines paired via Hoogsteen hydrogen bonds into quartets. While their presence within eukaryotic is known to play a key role in regulatory processes, functional mechanisms still under investigation. In the present work, we analysed nanomechanical properties of three G4s promoter KIT proto-oncogene from single-molecule point view through use magnetic tweezers (MTs). The study extension fluctuations negative supercoiling...
In the past two decades, significant efforts have been put into designing small molecules to target selected genomic sites where DNA conformational rearrangements control gene expression. G-rich sequences at oncogene promoters are considered good points of intervention since, under specific environmental conditions, they can fold non-canonical tetrahelical structures known as G-quadruplexes. However, emerging evidence a frequent lack correlation between molecule targeting G-quadruplexes and...
The binding properties toward the human telomeric G-quadruplex of two natural alkaloids coptisine and chelerythrine were studied using spectroscopic techniques, molecular modeling, X-ray diffraction analysis. results compared with reported data for parent compounds berberine sanguinarine. Spectroscopic studies showed modest, but different rearrangements DNA–ligand complexes, which can be explained considering particular stereochemical features these alkaloids, in spite similarity their...
I-motifs are non-canonical DNA structures consisting of two parallel strands held together by hemiprotonated cytosine-cytosine+ base pairs, which intercalate to form a ordered column stacked pairs. This unique structure covers potential relevance in various fields, including gene regulation and biotechnological applications. A structural feature (iM), is the presence sugar-sugar interactions through their extremely narrow minor grooves. Consistently, oligonucleotides containing pentose...
Abstract G-quadruplexes embedded within promoters play a crucial role in regulating the gene expression. KIT is widely studied oncogene, whose promoter contains three G-quadruplex forming sequences, c-kit1, c-kit2 and c-kit*. For these sequences available studies cover ensemble single-molecule analyses, although for kit* latter were limited to study on domain comprising all of them. Recently, has been reported fold according multi-step process involving folding intermediates. Here, by...
Mutation of the TET2 DNA-hydroxymethylase has been associated with a number immune pathologies. The disparity in phenotype and clinical presentation among these pathologies leads to questions regarding role mutation promoting disease evolution different cell types. Here we show that, primary mast cells, Tet2 expression is induced response chronic acute activation signals. In TET2-deficient via oncogenic KITD816V allele mastocytosis, selects for specific epigenetic signature characterized by...
1,10-Phenanthroline (Phen) derivatives are attractive ligands to provide metal complexes that selective for different DNA secondary structures. Herein, we analyze the binding processes of two bis-Phen analogues and their Ni(II) toward double-stranded telomeric G-quadruplex by calorimetric spectroscopic techniques. The free can adapt both arrangements. Conversely, ion coordination produces an increase in ligand affinity tetrahelical structure, whereas it dramatically decreases as a result...
Abstract Similarly to enzymes, functionalized gold nanoparticles efficiently catalyze chemical reactions, hence the term nanozymes. Herein, we present our results showing how surface‐passivated behave as synthetic nanonucleases, able cleave pBR322 plasmid DNA with highest efficiency reported so far for catalysts based on a single metal ion mechanism. Experimental and computational data indicate that have been successful in creating catalytic site precisely mimicking suggested natural...
Abstract Vimentin, a member of type III intermediate filaments (IFs), is cytoskeletal protein that covers multiple architectural and functional roles, including the maintenance organelle positioning in cytoplasm, regulation rearrangements, while more recently its potential involvement as regulatory factor gene expression emerged. Additionally, it involved cell migration epithelial-to-mesenchymal transition (EMT). In previous works, we identified Vimentin first known selectively binds...
The analysis of nucleic acid structures, topologies, nano-mechanics and interactions with ligands other biomacromolecules (most notably proteins) at the single molecule level has become a fundamental topic in molecular biophysics over last two decades. Techniques such as tweezers, single-molecule fluorescence resonance energy transfer, atomic force microscopy have enabled us to disclose an unprecedented insight into mechanisms governing gene replication, transcription regulation. In this...
Abstract I-Motifs (iM) are non-canonical DNA structures potentially forming in the accessible, single-stranded, cytosine-rich genomic regions with regulatory roles. Chromatin, protein interactions, and intracellular properties seem to govern iM formation at sites i-motif propensity (iMFPS) human cells, yet their specific contributions remain unclear. Using in-cell NMR oligonucleotide iMFPS models, we monitored iM-associated structural equilibria asynchronous cell cycle-synchronized HeLa...