Abstract Viral diseases cause significant harm to human health and often high mortality. In the past twenty years, humanity has undergone infection by SARS-CoV (severe acute respiratory syndrome), MERS-CoV (Middle East syndrome) COVID-19 coronaviruses, which spread from animals humans person person. These have led large economic losses. To fight coronaviruses other viruses, it is proposed use miRNAs, regulate protein synthesis at translational level. MirTarget program was used determine...

The importance of miRNA in cellular regulation is gaining momentum. Therefore, it interest to study human genes. Hence, the humanmRNA sequences (12,175) were searched for binding sites and 2,563predicted found. We observed that miR-3960 has more than 1000mRNA with high affinity (with ΔG/ΔGm values greater or equal 90%) 375genes. 565 5'UTRs 515 theCDS mRNAs. Nucleotide CDS encode polyalanine orpolyproline. It 73 mRNAs target genesencoded transcription factors. Thus, we document...

Normally, one miRNA interacts with the mRNA of gene. However, there are miRNAs that can bind to many mRNAs, and be target miRNAs. This significantly complicates study properties their diagnostic medical applications. The search 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs genes using MirTarget program has been completed. For miR-619-5p hybridization free energy bonds was equal 100% maximum potential energy. 201 have complete complementary 3'UTR (214 sites), CDS (3 5'UTR (4...

We identified the interaction sites of several miRNAs with mRNAs from paralogs and orthologs SPL HAM genes in A. thaliana . miR156 miR157 families are shown to have binding within genes. The ath-miR156a–j located contain sequence GUGCUCUCUCUCUUCUGUCA. This encodes ALSLLS motif. miR157a–d bind family at same site. suggest merging into one family. Several eight plants conserved sites. GUGCUCUCUCUCUUCUGUCA polynucleotide is homologous its hexapeptide also proteins these plants. Binding for...

A prolonged pandemic with numerous human casualties requires a rapid search for means to control the various strains of SARS-CoV-2. Since only part population is affected by coronaviruses, there are probably endogenous compounds preventing spread these viral pathogens. It has been shown that piRNA (PIWI-interacting RNAs) interact mRNA genes and can block protein synthesis at stage translation. Estimated effects on SARS-CoV-2 genomic RNA (gRNA) in silico. cluster 13 binding sites (BS) gRNA...

This study examined binding sites of 2,578 miRNAs in the mRNAs 12,175 human genes using MirTarget program. It found that miR-1273 family have between 33 and 1,074 mRNA target genes, with a free hybridization energy 90% or more its maximum value. The consists miR-1273a, miR-1273c, miR-1273d, miR-1273e, miR-1273f, miR-1273g-3p, miR-1273g-5p, miR-1273h-3p, miR-1273h-5p. Unique (miR-1273e, miR-1273g-3p) than 400 genes. We established 99 nucleotide sequences contain arranged for family. High...

The binding of 2,578 human miRNAs with the mRNAs 12,175 genes was studied. It established that miR-619-5p, miR-5095, miR-5096, and miR-5585-3p bind high affinity to 1215, 832, 725, 655 genes, respectively. These unique have sites in coding sequences untranslated regions mRNAs. many multiple sites. Groups which ordering differ were established. possible functional evolutional properties are discussed.

In the present article, a solution for problem of gene scanning purpose prediction binding sites miRNA with matrix RNA (mRNA) is proposed.A mathematical model optimal process genes and sequences was developed.An algorithm using one gap in sequence maximum (as percentage ratio) free energy developed analysed regard to coincidence particular on basis complementarity.The constructed parallelised fragmented computational cluster use MPJ tools.

Exogenous microRNAs (miRNAs) enter the human body through food, and their effects on metabolic processes can be considerable. It is important to determine which miRNAs from plants affect expression of genes extent influence.

Milk and other products from large mammals have emerged during human evolution as an important source of nutrition. Recently, it has been recognized that exogenous miRNAs (mRNA inhibited RNA) contained in milk tissues the mammalian body can enter body, which turn ability to potentially regulate metabolism by affecting gene expression. We studied for Bos taurus are contain could act postprandially regulators The interaction 17,508 genes with 1025 bta-miRNAs, including 245 raw was studied....

The variability of nucleotide repeats is considered one the causes diseases, but their biological function not understood. In recent years, interaction miRNAs and piRNAs with mRNAs genes responsible for developing neurodegenerative oncological diseases diabetes have been actively studied. We explored candidate to predict associations piRNAs. parameters piRNA binding sites human having were determined using MirTarget program. This program defines start initiation miRNA mRNAs, localization in...

miRNAs regulate the expression of many genes and are involved in development diseases. We studied that interact partly or fully complementarily with 5'UTR, CDS 3'UTR mRNAs target genes. The MirTarget program used this study allows for discovery miRNA binding sites (BS) entire nucleotide sequence mRNA determining characteristics interactions mRNAs. identified five pairs complementary BS miR-127-5p miR-127-3p, miR-136-5p miR-136-3p, miR-431-5p miR-431-3p, miR-432-5p miR-432-3p, miR-433-5p...

Multiple sclerosis (MS) is a common inflammatory demyelinating disease with high mortality rate. MS caused by many candidate genes whose specific involvement has yet to be established. The aim of our study was identify endogenous miRNAs and piRNAs involved in the regulation gene expression using bioinformatic methods. A program used quantify interaction miRNA piRNA nucleotides mRNA target genes. We 7310 from three databases 40,000 piRNAs. mRNAs revealed binding sites (BSs), which were...

Transcription factor gene ZFHX3 is one of the candidate genes involved in stroke development. The protein contains oligopeptides encoded by trinucleotide repeats (TNRs). TNR variability considered to be causes disease, but their biological function has not yet been established. We assume that TNRs are binding sites miRNA mRNA and regulation expression. characteristics miRNA–mRNA interaction were determined using MirTarget software. It shown first human consists seven consecutive...

The development of breast cancer (BC) subtypes is controlled by distinct sets candidate genes, and the expression these genes regulated binding their mRNAs with miRNAs. Predicting miRNA associations target thus essential when studying cancer. MirTarget program identifies initiation to mRNA, localization sites in mRNA regions, free energy from all nucleotides mRNA. Candidate gene have clusters (miRNA overlapping nucleotide sequences). EPOR, MAZ NISCH HER2 subtype clusters, there are four MAZ,...

Abstract The possibility of using miRNA (mRNA-inhibiting RNA) to inhibit infections caused by the coronaviruses COVID-19, SARS-CoV, and MERS-CoV has been shown. Using bioinformatics approaches, completely complementary (cc-miRNA) complexes were predicted be able bind translation coronavirus proteins replication genomes. For seven cc-miRc for cc-miRs eight cc-miRm MERS-CoV, interactions with RNA genomes (gRNAs) corresponding was evaluated. free energy cc-miRNAs binding sites significantly...

The involvement of genes and miRNAs in the development atherosclerosis is a challenging problem discussed recent publications. It necessary to establish which affect expression candidate genes. We used known predict associations. quantitative characteristics interactions with mRNA were determined using program, identifies localization miRNA binding sites mRNA, free energy interaction mRNA. In mRNAs GAS6 NFE2L2 genes, 21 15 miRNAs, respectively, identified. IRS2 25 located cluster 41 nt....

We searched for 2,563 microRNA (miRNA) binding sites in 17,494 mRNA sequences of human genes. miR-1322 has more than 2,000 1,058 genes with ΔG/ΔG m ratio 85% and more. 1,889 CDSs, 215 5' UTRs, 160 3' UTRs. From two to 28 have arranged localization the start position through three nucleotides each following site. The nucleotide these CDSs encode oligopeptides same and/or different amino acid sequences. found that 33% target encoded transcription factors. orthologous MAMLD1, MAML2, MAML3 These...

Abstract Background: In the past twenty years humankind has effected from infection caused by SARS-CoV (severe acute respiratory syndrome), MERS-CoV (Middle East syndrome) and COVID-19 coronaviruses, which have significant harm to human health resulted in high mortality. The possibility of using miRNA (mRNA-inhibiting RNA) inhibit infections coronaviruses COVID-19, SARS-CoV, been shown. Methods: MirTarget program determines following characteristics interaction between miRNAs messenger RNAs...