A5013566655- Primate Behavior and Ecology
- Forest Ecology and Conservation
- Medicinal Plant Research
- Aquatic life and conservation
- Agricultural and Environmental Management
- Wildlife Ecology and Conservation
- Oil Palm Production and Sustainability
- Livestock Farming and Management
- Plant and Fungal Species Descriptions
- Identification and Quantification in Food
- Agriculture and Agroindustry Studies
- Species Distribution and Climate Change
- Evolution and Paleontology Studies
- Bat Biology and Ecology Studies
- Molecular Biology Techniques and Applications
- Ecology and Vegetation Dynamics Studies
- Spider Taxonomy and Behavior Studies
- Marine and Coastal Ecosystems
- Rabbits: Nutrition, Reproduction, Health
- Animal Vocal Communication and Behavior
- Agricultural and Biological Research
- Animal Ecology and Behavior Studies
- Amphibian and Reptile Biology
- Food and Agricultural Sciences
- Genomics and Phylogenetic Studies
Andalas University
2016-2025
Encana (Canada)
2017
Abstract. Syamsi F, Novarino W, Dahelmi, Chairul. 2025. The study of diversity and distribution bats in several fragmented forests small adjacent islands Batam City, Riau Island, Indonesia. Biodiversitas 26: 223-232. Bats are ecologically taxonomically diverse crucial tropical ecosystems, including on islands. This compares bat urban connected by bridges to assess the impact urbanization populations, providing insights for conservation habitat management. We sampled across four sites...
The Sumatran striped rabbit (Nesolagus netscheri) lacks specific primers to amplify the chytochrome oxidase 1 (CO1) gene and b (cytb) gene, at present. Therefore, it is important design CO1 cytb in N. netscheri. aim of this study compare primer methods used, namely Primer-BLAST AliView programs, for genes This research was conducted using descriptive method with molecular observation. In study, primers, [(forward: 5' TGTATGATATGGGGGAGGGC 3'), (reverse: TGGTCCGTCCTTATTACAGCG 3')] cytochrome...
Avitourism is a form of tourism that focuses on bird watching intheir natural habitat. The existence mangrove forests very important in anarea because it habitat for various types wildlife, especially birds. Thisstudy aims to analyze diversity and its potential activities theMandeh ecosystem area. This research was conducted fromFebruary April 2024. method used the point count method. Datacollection species numbers carried out at 15 observation points.The distance each 150 meters with an...
ABSTRACT Sundaic giant tortoises ( Manouria emys ) are the largest chelonians in Asia. Classified as critically endangered, they extremely rare throughout their range. The limited knowledge of behavior and ecology hampers effective conservation initiatives. We integrated GPS tracking, behavioral observations, local ecological knowledge, resource selection functions, spatial distribution modeling, landscape functional connectivity to assess key aspects food habits, movement patterns, habitat...
Information on tropical Asian vertebrates has traditionally been sparse, particularly when it comes to cryptic species inhabiting the dense forests of region. Vertebrate populations are declining globally due land-use change and hunting, latter frequently referred as "defaunation." This is especially true in Asia where there extensive high human densities. Robust monitoring requires that large volumes vertebrate population data be made available for use by scientific applied communities....
The main authorities and practitioners face crucial challenges in safeguarding wildlife conservation areas due to massive direct anthropogenic disturbances, such as illegal logging, habitat conversion into human development areas, poaching. Therefore, measuring the effectiveness of protection is essential for wider intervention. This study aimed examine patrol using measurable effort parameters SMART-based data collection Rimbang Baling Bukit Betabuh, Sumatra. We conducted a series planned...
Land use change is an important issue for urban and regional planners policy makers, but it also very useful in conservation planning, food security, hydrological modeling. Data, information analysis tools become obstacles detecting changes land use. With increasing access to data current technology, hoped that observations can be carried out a simple way have more accurate results. This study aimed analyze cover Padang City 2018-2022, using Landsat Imagery Geographic Information System...
Abstract. Ashrifurrahman, Simamora S, Ritonga R, Novarino W, Tjong DH, Rizaldi, Syaifullah, Roesma DI. 2022. Sumatran tiger identification and phylogenetic analysis based on the CO1 gene: molecular forensic application. Biodiversitas 23: 1788-1794. Wild animal hunting, especially in (Panthera tigris sumatrae), has been caused population decline. Regulation law enforcement have implemented even though it does not affect optimal because of trickery poachers illegal traders. Sometimes, evidence...
Abstract. Akbar MA, Rizaldi, Novarino W, Perwitasari-Farajallah D, Tsuji Y. 2019. Activity budget and diet in silvery lutung Trachypithecus cristatus at Gunung Padang, West Sumatra, Indonesia. Biodiversitas 20: 719-724. We studied the activity of a group wild lutungs (Trachypithecus cristatus) Indonesia, with special attention to age-and sex-related differences. conducted behavioral observations between July October 2016, found that resting constituted greatest proportion their daily...
Research on the Snakes Morphological Characteristics Campus of Andalas University Limau Manih had been done. The research was conducted using survey method and Dissemination Information to Public accompanied by morphometric measurements descriptions. results that done caught 2 species consist one family namely Elapidae. This is refer snakes which has neurotoxin venom glands, no loreal scalation, mostly teresterial. Maticora bivirgata flaviceps (Cantor, 1839) scale, red coloration tail, head;...
Guild composition and niche breadth are important point on avian studies. This paper describes the guild of understorey bird in Sipisang, West Sumatra. The study was conducted since May 2002 until October 2004 for approximately 10 days each month (totally 284 or 51.120 net.hours). Fifteen mist nets were operated ground level separately three locations, which made 60 m line each. Mist from 6.00 AM 18.00 PM, checked every two hours. captured birds identified, ringed, measured, weighted,...
Abstrak: This study aims to analyze governance and harvest fish Lubuk Larangan Rantau Pandan Village Bungo Resindence. research is carried in March-August 2015 a river of Residence, Jambi. The metod that used survey method. Then using SWOT analysis with regard assesses each internal external factors. Based on the observation efforts made by communities around bottom prohibition only covers preservation species alone lack cooperation between government surrounding community.
The study on aggressive behavior of long-tailed macaques has been conducted from May to July 2016 at Gunung Meru, Padang, West Sumatra. This aimed compare between provocated and non-provocated behaviors the toward human visitors Meru feeding site. used all-occurrence sampling method record interactions along behavior. One or more were followed for ten minutes monkey ground a total 78.5 hours. either considerably high intensity level, including body contact biting. Feeding contexts (i.e. food...
Penelitian tentang variasi morfologi katak pohon Polypedates leucomystax Gravenhorst, 1829 (Anura; Rhacophoridae) di Sumatera Barat telah dilakukan dari bulan Maret sampai September 2014. Pengambilan sampel Dharmasraya, Padang Panjang, Pasaman Timur, Solok, Padang, Pesisir Selatan dan Kayu Aro dengan metode survey koleksi langsung lapangan, kemudian dilanjutkan Laboratorium Taksonomi Hewan Jurusan Biologi Fakultas MIPA Universitas Andalas untuk pengukuran karakter morfometrik meristik. Hasil...