A5021064727- Cancer-related molecular mechanisms research
- Breast Cancer Treatment Studies
- Genetic and phenotypic traits in livestock
- Cancer-related Molecular Pathways
- Regional Economic and Spatial Analysis
- RNA modifications and cancer
- Safety and Risk Management
- Lymphatic System and Diseases
- Breast Lesions and Carcinomas
- Adipose Tissue and Metabolism
- Cancer Cells and Metastasis
- Cancer Genomics and Diagnostics
- Animal Genetics and Reproduction
- Glycosylation and Glycoproteins Research
- RNA Research and Splicing
- Cancer-related gene regulation
- Ubiquitin and proteasome pathways
- Genetic Mapping and Diversity in Plants and Animals
- Carbon and Quantum Dots Applications
- HER2/EGFR in Cancer Research
- Toxic Organic Pollutants Impact
- Nanocluster Synthesis and Applications
- RNA and protein synthesis mechanisms
- Effects and risks of endocrine disrupting chemicals
- Adipokines, Inflammation, and Metabolic Diseases
Second Affiliated Hospital of Dalian Medical University
2016-2025
Dalian Medical University
2016-2025
Northwest A&F University
2017-2024
Guilin Medical University
2024
Inner Mongolia University
2006-2023
Yanshan University
2023
Dalian University
2014-2021
First Hospital of Qinhuangdao
2021
Dalian Jinzhou First People's Hospital
2021
China Electric Power Research Institute
2017
We report the finding of presence fluorescent carbon dots in commercial beer and TEM analysis reveals that (BCDs) have an average size 2.5 nm.
AIM:To investigate the effect of sulforaphane (SFN) on regulation NF-E2-related factor-2 (Nrf2)-antioxidant response element (ARE) pathway in liver injury induced by intestinal ischemia/reperfusion (I/R). METHODS:Rats were divided randomly into four experimental groups: control, SFN I/R and pretreatment groups (n = 8 each group).The model was established clamping superior mesenteric artery for 1 h 2 reperfusion.In group, surgery performed as with intraperitoneal administration 3 mg/kg before...
<b>Background</b> Microsurgical vascularized lymph node transfer (VLNT) and supermicrosurgical lymphaticovenular anastomosis (LVA) are increasingly performed to treat lymphedema. The surgical outcome is commonly assessed by volume-based measurement (VBM), a method that not consistently reliable. We describe indocyanine green (ICG) lymphography as an alternative postoperative tracking modality after lymphatic reconstruction with VLNT LVA. <b>Methods</b> LVA were in patients therapy-refractory...
BackgroundCancer patients had been profoundly affected by the outbreak of COVID-19 especially after quarantine restrictions in China. We aimed to explore treatment changes and delays early breast cancer (EBC) during first quarter 2020.MethodsWe did this retrospective, multicentre, cohort study at 97 centres EBC who received regardless preoperative therapy, surgery or postoperative therapy 2020 were included.Findings8397 eligible with a median age 50 (IQR 43–56). 0·2% (15/8397) confirmed as...
The outstanding thermoelectric materials SnSe is also known for its inferior mechanical properties, which bring great inconvenience application in devices. In this work, bulks were prepared via a sequential procedure of high-pressure synthesis, ball milling, and spark plasma sintering. produced polycrystalline samples with unique microstructure tightly-bound quasi-equiaxed grains exhibited excellent properties. Vickers hardness, compressive strength, bending strength reached 1.1 GPa, 300...
Abstract Background Breast cancer (BC) remains a prevalent and common form of with high heterogeneity. Making efforts to explore novel molecular biomarkers serve as potential disease indicators, which is essential effectively enhance the prognosis individualized treatment BC. FBXO proteins act core component E3 ubiquitin ligase, play regulators roles in multiple cellular processes. Recently, research has indicated that FBXOs also significant development. However, functions these family...
Purpose: Secondary chronic lymphedema is a complication that seriously affects the quality of life cancers survivors which urgent to be studied. However, current animal models generally have some defects such as short duration affect research process. To acquire an model easier accomplish well higher success rate main goal our experiment. Methods: The hind limb rats with secondary was established by near infrared fluorescence-guided lymphatic system destruction combined high-fat diet...
The GH growth axis plays an important role in the and development of animals runs through whole life animals. Many studies have shown that molecular mutations key genes will affect purpose this study was to explore distribution characteristics InDels GHR, GHRH, GHRHR seven Chinese sheep populations, further relationship between traits. GHR showed high variation sheep, GHR-53 highest minimum allele frequency (MAF). There only one InDel mutation site both GHRH GHRHR. genotype frequencies Hu...
Breast cancer (BC), an extremely aggressive malignant tumor, causes a large number of deaths worldwide. In this study, we pooled profile datasets from three cohorts to illuminate the underlying key genes and pathways BC. Expression profiles GSE42568, GSE45827, GSE124646, including 244 BC tissues 28 normal breast tissues, were integrated analyzed. Differentially expressed (DEGs) screened out based on these datasets. Functional analysis Gene Ontology (GO) Kyoto Encyclopedia Genome (KEGG)...
The transportation is a crucial phase in beef cattle industry, and the annual losses caused by transport stress are substantial. Several studies have described effect of long distance on animal health, such as disorder nervous, endocrine, immune, metabolic system. However, molecular mechanisms underlying short still poorly understood. Present study aims to investigate measuring hematological indices transcriptomic analysis. In this study, total 10 Qinchuan were used compare characteristics...
As important livestock in Qinghai-Tibet Plateau, yak provides meat and other necessities for Tibetans living. Plateau has resistance to diseases stress, yet is nearly unknown the structure expression mechanism of immunoglobulin loci. Based on published genes bovids (cattle, sheep goat), genomic organization heavy chain (IgH) light (IgL) were described. The assemblage diversity IgH, Igλ Igκ was similar that bovids, contributes little antibody lineage compared with humans mice. Somatic...
Abstract Background Accurately predicting the response to neoadjuvant chemotherapy (NAC) in breast cancer patients is crucial for guiding treatment strategies and enhancing clinical outcomes. Current studies have primarily focused on a limited set of biomarkers. More importantly, results many are conflict. To address this, we conducted comprehensive evaluation predictive value diverse range clinically available molecular biomarkers cancer, including HER2, ER, PR, TOPO II, EGFR, Ki67, CK5/6,...
Globally, breast cancer is the most common malignancy among women and thyroid also one of types women. Patients with exhibit a higher incidence than that noted in general population. The exact mechanism multiple tumors remains elusive. In present study, case patient harboring gene mutation reported. Specifically, lymphoepithelioma-like carcinoma (LELC-B) described. It was hypothesized short interval between onset these two malignant tumor may be related to TP53 status patient. To date,...
Intestinal ischemia-reperfusion (I/R) injury is a serious clinical pathophysiological process that may result in acute local intestine and remote liver injury. Protocatechuic acid (PCA), which has been widely studied as polyphenolic compound, induces expression of antioxidative genes combat oxidative stress cell apoptosis. In this study, we investigated the effect PCA pretreatment for protecting intestinal I/R-induced mice. I/R was established by superior mesenteric artery occlusion 45 min...
Abstract. Belonging to the same LIM homeobox (LHX) family, LHX3 and LHX4 are key transcription factors in animal growth reproduction. Insertion/deletion (indel) is a relatively simple effective DNA marker. Therefore, four sheep breeds of various fecundity were used explore novel indel variants within gene, as well evaluate their effects on traits. Herein, only one 29 bp (NC_019460.2:g.3107494-3107522delGGCCTGGACTGTGATGGGCACCCTCCGGG) gene was found, three genotypes detected. Interestingly,...
Breast cancer is a major contributor leading to death in females worldwide. The aim of the present study was investigate effects microRNA-98 (miR-98) on processes cell proliferation, invasion, migration and apoptosis by binding high-mobility group AT-hook 2 (HMGA2) breast cancer. tissues adjacent normal were collected from 112 patients suffering target relationship between miR-98 HMGA2 verified connection with bioinformatics website as well dual-luciferase reporter assay, both which provided...