A5030585108- Nerve injury and regeneration
- Neurogenesis and neuroplasticity mechanisms
- Signaling Pathways in Disease
- Nuclear Receptors and Signaling
- Neuroscience and Neuropharmacology Research
- RNA regulation and disease
- Axon Guidance and Neuronal Signaling
- Alzheimer's disease research and treatments
- RNA Research and Splicing
- Melanoma and MAPK Pathways
- RNA Interference and Gene Delivery
- Cell death mechanisms and regulation
- Cytokine Signaling Pathways and Interactions
- NF-κB Signaling Pathways
- Endoplasmic Reticulum Stress and Disease
- Ubiquitin and proteasome pathways
- Tuberous Sclerosis Complex Research
- Neuroinflammation and Neurodegeneration Mechanisms
- Angiogenesis and VEGF in Cancer
- Protein Tyrosine Phosphatases
- Cellular Mechanics and Interactions
- Redox biology and oxidative stress
- Virus-based gene therapy research
- Neuropeptides and Animal Physiology
- Epigenetics and DNA Methylation
The Ohio State University
2013-2024
Columbus Oncology and Hematology Associates
2020
The Ohio State University Wexner Medical Center
2002-2017
Neurological Surgery
2014
The Ohio State University Comprehensive Cancer Center – Arthur G. James Cancer Hospital and Richard J. Solove Research Institute
2014
University of Bristol
2008
Inserm
2008
Amsterdam UMC Location Vrije Universiteit Amsterdam
2008
MultiMedica
2008
University of Parma
2008
In addition to its role as a survival factor, nerve growth factor (NGF) has been implicated in initiating apoptosis restricted cell types both during development and after terminal differentiation. NGF binds the TrkA tyrosine kinase p75 neurotrophin receptor, member of tumor necrosis cytokine family. To understand mechanisms underlying versus death decisions, receptor was introduced into oligodendrocyte cultures that undergo p75-dependent manner. Here we report activation oligodendrocytes...
Although Aβ peptides are causative agents in Alzheimer's disease (AD), the underlying mechanisms still elusive. We report that Aβ42 induces a translational block by activating AMPK, thereby inhibiting mTOR pathway. This leads to widespread ER stress, which activates JNK3. JNK3 turn phosphorylates APP at T668, facilitating its endocytosis and subsequent processing. In support, pharmacologically blocking translation results significant increase JNK3-dependent manner. Thus, activation, is...
The unprocessed precursor of the neurotrophin nerve growth factor (NGF), proNGF, has been suggested to be a death-inducing ligand for receptor p75. Whether proNGF is true pathophysiological that secreted, binds p75, and activates cell death in vivo , however, remained unknown. Here, we report after brain injury, was induced secreted an active form capable triggering apoptosis culture. We further demonstrate p75 disruption this binding results complete rescue injured adult corticospinal...
The neurotrophin receptor p75 can induce apoptosis both in vitro and vivo. mechanisms by which induces have remained mostly unknown. Here, we report that activates Rac GTPase, turn c-jun N-terminal kinase (JNK), including an injury-specific JNK3, NGF-dependent manner. N17Rac blocks this JNK activation subsequent apoptosis, indicating of GTPase is required for induced p75. In addition, p75-mediated modulated coactivation Trk, identifying as one the key molecules whose activity critical cell...
The lack of effective therapies for spinal cord injury points to the need identifying novel targets therapeutic intervention. Here we report that a small molecule, LM11A-31, developed block proNGF-p75 interaction and p75-mediated cell death crosses blood–brain barrier efficiently when delivered orally. Administered starting 4 h postinjury, LM11A-31 promotes functional recovery without causing any toxicity or increased pain in mouse model contusion injury. In both weight-bearing open-field...
Studies showing that neurotrophin binding to p75 NTR can promote cell survival in the absence of Trk (tropomyosin-related kinase) receptors, together with recent structural data indicating NGF may bind a monovalent manner, raise possibility small molecule ligands positively regulate might be found. A pharmacophore designed capture selected and physical chemical features domain known interact was applied silico screening libraries. Small, nonpeptide, monomeric compounds were identified . In...
Microglia undergo two-stage activation in neurodegenerative diseases, known as disease-associated microglia (DAM). TREM2 mediates the DAM2 stage transition, but what regulates first DAM1 transition is unknown. We report that glucose dyshomeostasis inhibits and PKM2 plays a role. As tumors, was aberrantly elevated both male female human AD brains, unlike it expressed active tetramers, well among + surrounding plaques 5XFAD mice. snRNAseq analyses of without Pkm2 mice revealed significant...
To elucidate the role of epigenetic reprogramming in cell- or tissue-specific differentiation, we explored DNA methyltransferases (Dnmts) nerve growth factor (NGF)-induced differentiation PC12 (pheochromocytoma) cells into neuronal cells. The mRNA and protein levels de novo methyltransferase Dnmt3b increased, whereas those Dnmt3a Dnmt1 decreased, during NGF-induced neurite outgrowth. localized nucleus, as well growing neurites. When expression was inhibited by antisense small interfering...
The enhancer of the rat tyrosine hydroxylase gene (TH) in PCSb cells is composed AP1 motif (TCAT-TCA, -205 to -199) and an overlapping 20-base pair dyad symmetry element (TCAGAGGCAGGTGCCTGTGA, -201 -182) whose core E-box.We have isolated two partial cDNA clones that encode factors which bind TH-dyad.One rITF2 with a basic helix-loop-helix other CDPB homeodomain.rITF2 homolog human ITF2 (or E2-2), member new family homeoproteins defined by histidine as 9th residue recognition helix unique 64...
Investigation of neuroendocrine genes has revealed that transcription is regulated via multiple DNA binding sites, including the cyclic AMP response element (CRE). We show here for neuronal and chromaffin-specific gene tyrosine hydroxylase (TH), a 70-bp region (-229 to -160) lacking CRE sufficient, in either orientation, confer levels chloramphenicol acetyltransferase reporter expression equivalent or greater than conferred by 4.8 kb rat TH enhancer/promoter region. The contains potential...
Diabetes impairs endothelial function and reparative neovascularization. The p75 receptor of neurotrophins (p75 NTR ), which is scarcely present in healthy cells (ECs), becomes strongly expressed by capillary ECs after induction peripheral ischemia type-1 diabetic mice. Here, we show that gene transfer-induced expression the survival, proliferation, migration, adhesion capacities cultured progenitor (EPCs) inhibits angiogenesis vitro. Moreover, intramuscular delivery neovascularization blood...
Abstract Astrocytes have an important role in synaptic formation and function but how astrocytic processes become associated with structures during development is not well understood. Here we analyzed the pattern of growth extending off main Bergmann glial (BG) shafts synaptogenesis cerebellum. We found that this period, BG process outgrowth was correlated increased ensheathment dendritic spines. In addition, two‐photon time‐lapse imaging revealed were highly dynamic, became more stable as...
Axonal mRNA transport is robust in cultured neurons but there has been limited evidence for this vivo . We have used a genetic approach to test axonal of reporter mRNAs. show that β-actin's 3′-UTR can drive localization GFP mature DRG neurons, mice with γ- actin's no mRNA. Peripheral axotomy triggers the β- actin containing transgene into axons. This GFP-3′- accumulates injured PNS axons before activation promoter peaks DRG. Spinal cord injury also increases signals carrying without any...
Angiogenesis produces primitive vascular networks that need pruning to yield hierarchically organized and functional vessels. Despite the critical importance of vessel patterning function, mechanisms regulating this process are not clear. Here we show EphrinB2, a well-known player in angiogenesis, is an essential regulator endothelial cell death pruning. This regulation depends upon phosphotyrosine-EphrinB2 signalling repressing c-jun N-terminal kinase 3 activity via STAT1. JNK3 activation...