A5056031390- Aquaculture Nutrition and Growth
- Reproductive biology and impacts on aquatic species
- Fish Ecology and Management Studies
- Fish Biology and Ecology Studies
- Environmental Toxicology and Ecotoxicology
- Pharmaceutical and Antibiotic Environmental Impacts
- Fish biology, ecology, and behavior
- Aquaculture disease management and microbiota
- Ichthyology and Marine Biology
- Pain Mechanisms and Treatments
- Animal Behavior and Reproduction
- Amphibian and Reptile Biology
- Essential Oils and Antimicrobial Activity
- Fatty Acid Research and Health
- Genomics and Phylogenetic Studies
- Aquatic Ecosystems and Phytoplankton Dynamics
- Wildlife Ecology and Conservation
- Neurotransmitter Receptor Influence on Behavior
- Fibromyalgia and Chronic Fatigue Syndrome Research
- Marine and fisheries research
- Biochemical effects in animals
- Insect and Arachnid Ecology and Behavior
- Acute Lymphoblastic Leukemia research
- Physiological and biochemical adaptations
- Epigenetics and DNA Methylation
Universidade de São Paulo
2013-2024
Universidade Estadual Paulista (Unesp)
2024
Universidad de Lima
2024
Universidade Federal Fluminense
2023
657 Oslo
2016
Universidade do Estado do Rio de Janeiro
2009-2013
University of Aveiro
2009
Diclofenac (DCF) and caffeine (CAF) are persistent pharmaceuticals that occur in mixtures the aquatic ecosystems causing effects reproductive physiology of organisms. This study evaluated physiological responses Astyanax altiparanae males exposed to nominal concentrations DCF (3.08 mg L−1) CAF (9.59 separately combined, for 96 h. The steroids profile, estrogenic biomarker vitellogenin (vtgA), testes liver morphology, also mortality were assessed. degradation was 5% initial concentration 24...
Paradoxical sleep deprivation (PSD) increases pain sensitivity and reduces morphine antinociception. Because dopaminergic neurons in the periaqueductal gray matter (PAG) participate modulation opioid-induced antinociception, we evaluated effects of PSD on thermal sensitivity, morphine- L-DOPA-induced antinociception functionality PAG by assessing tyrosine hydroxylase (TH) immunoreactivity. Rats that were subjected to 96h received vehicle, (2.5, 5 or 10mg/kg), L-DOPA (50 100mg/kg)...
Abstract Eutrophication results in a deficiency of n‐3 LC‐PUFA (long‐chain polyunsaturated fatty acids) aquatic food chains, affecting fish nutrition and physiology. The trophic transfer FA (fatty to species different feeding habits was investigated two reservoirs southeast Brazil—the mesotrophic Ponte Nova Reservoir (PN) the hypereutrophic Billings (Bil). Total profile stomach contents adipose tissue, triacylglycerols (TAG), phospholipids (PL) from liver muscle omnivorous Astyanax fasciatus...
Throughout evolutionary history, elasmobranchs have developed diverse reproductive strategies. Little focused work, however, has addressed how neonatal nutritional state is affected by differing degrees of maternal investment associated with these markedly different To investigate the effect on quality pups during early life history an extremely viviparous elasmobranch, quantitative biomarker analysis including lipids, fatty acids and stable isotopes was conducted. Using cownose ray...
Sleep deprivation has been associated with hyperalgesia in humans and animal models. The tricyclic antidepressant amitriptyline is used as an analgesic drug patients models of chronic pain, including that spinal nerve injury. Pain hypersensitivity following paradoxical sleep (PSD) peripheral injury seem to share common mechanisms. Accordingly, we evaluated the effects (acutely chronically administered) on increased thermal response observed PSD rats (72 or 96 h). Rats were for sensitivity...
Among vertebrates, amphibians are characterized by a great diversity of reproductive modes, including several forms parental care. Caecilians, comprising the order Gymnophiona, one most poorly known vertebrate groups due to their Gondwanan distribution and primarily fossorial habits. Information about biology can contribute overall understanding amphibians. The present review aims encourage research on this group providing an overview caecilian reproduction, with greater detail some topics...
ABSTRACT This study aimed at analyzing the energetic substrate (ES) in main storage tissues of Steindachneridion parahybae, throughout reproductive cycle captivity. Differently from wild, captivity, feeding is not interrupted during period, females do spawn spontaneously, and they are sedentary. Adult were sampled monthly based on their histology gonadosomatic index (GSI), ovaries classified into: previtellogenic (PRV), vitellogenic (VTG), regression (REG) stages. Ovaries VTG stage showed...
Although interspecific trophic interactions plays a principal role within elasmobranch communal nurseries, little is known over variation in foraging strategies adopted by young-of-year of sympatric species. To test the hypothesis dietary resource partitioning between batoids nursery, we investigated two cownose ray species, Rhinoptera bonasus and R. brasiliensis, which occur heterospecific groups, strategy predicted to increase survival success. Using biochemical tracers, fatty acids (FA)...
For gene expression studies, endogenous genes are necessary for analysis. Therefore, ribosomal protein L7 (rpl7) was chosen as and designed according to the liver’s transcriptome of Astyanax lacustris. During primer design, it mainly considering temperature close 60ºC absence dimers, establishing following sequences: GGCCCAGCTGGTTGTGATCGCA (Forward, 5′–3′) GCCTCCACCAGTTTGGCAAGAGC (Reverse, 5′–3′).
The reproductive physiology of fish can be changed by the presence pollutants in water, which act as endocrine disrupting compounds (EDC). We evaluated impacts water contaminants polluted reservoirs acting possible EDC on Astyanax fasciatus and Hoplias malabaricus males. used biomarkers with different levels biological organization. adult males were collected summer winter at five sites Tietê River Basin: Ponte Nova reservoir (PN), considered a reference site due to low anthropogenic...