A5014978932- Chemical Synthesis and Analysis
- Monoclonal and Polyclonal Antibodies Research
- Crystallization and Solubility Studies
- X-ray Diffraction in Crystallography
- Radiopharmaceutical Chemistry and Applications
- Glycosylation and Glycoproteins Research
- Click Chemistry and Applications
- Malaria Research and Control
- DNA and Nucleic Acid Chemistry
- Advanced biosensing and bioanalysis techniques
- Neuropeptides and Animal Physiology
- Pregnancy-related medical research
- Biochemical and Structural Characterization
- RNA and protein synthesis mechanisms
- Supramolecular Self-Assembly in Materials
- Receptor Mechanisms and Signaling
- Antimicrobial Peptides and Activities
- Alzheimer's disease research and treatments
- RNA Interference and Gene Delivery
- Venomous Animal Envenomation and Studies
- Growth Hormone and Insulin-like Growth Factors
- Cell Adhesion Molecules Research
- Mosquito-borne diseases and control
- Ubiquitin and proteasome pathways
- Electron Spin Resonance Studies
The University of Adelaide
2011-2023
The University of Melbourne
1984-2013
La Trobe University
2011
Commonwealth Scientific and Industrial Research Organisation
1984-2009
Virginia Tech
2009
Biotechnology Institute
2009
Florey Institute of Neuroscience and Mental Health
1984-2008
Ludwig Cancer Research
1985-2007
Australian Centre for Disease Preparedness
1994-2001
University of Wyoming
1994
The predatory ecology of Varanus komodoensis (Komodo Dragon) has been a subject long-standing interest and considerable conjecture. Here, we investigate the roles potential interplay between cranial mechanics, toxic bacteria, venom. Our analyses point to presence sophisticated combined-arsenal killing apparatus. We find that lightweight skull is relatively poorly adapted generate high bite forces but better resist pulling loads. reject popular notion regarding bacteria utilization. Instead,...
Venom has only been recently discovered to be a basal trait of the Anguimorpha lizards. Consequently, very little is known about timings toxin recruitment events, venom protein molecular evolution, or even relative physical diversifications system itself. A multidisciplinary approach was used examine evolution across full taxonomical range this ∼130 million-year-old clade. Analysis cDNA libraries revealed complex transcriptomes. Most notably, three new cardioactive peptide types were...
New bifunctional derivatives of diacetyl-bis(4-methylthiosemicarbazone) (H(2)atsm) have been prepared by a selective transamination reaction new dissymmetric bis(thiosemicarbazone) precursor H(2)L(1). The contain an aliphatic carboxylic acid (H(2)L(2) and H(2)L(3)), t-butyl carbamate (H(2)L(4)), or ammonium ion (H(2)L(5)) functional group. ligands copper(II) complexes characterized NMR spectroscopy, mass spectrometry, microanalysis. complex Cu(II)(L(4)) was structurally X-ray crystallography...
The origin and evolution of venom proteins in helodermatid lizards were investigated by multidisciplinary techniques. Our analyses elucidated novel toxin types resultant from three unique domain-expression processes: 1) first full-length sequences lethal isoforms (helofensins) revealed this type to be constructed an ancestral monodomain, monoproduct gene (beta-defensin) that underwent tandem domain duplications encode a tetradomain, with possible protein fold; 2) monodomain (encoding...
Abstract Chemical synthesis of peptides can allow the option sequential formation multiple cysteines through exploitation judiciously chosen regioselective thiol‐protecting groups. We report use 2‐nitroveratryl (oNv) as a new orthogonal group that be cleaved by photolysis under ambient conditions. In combination with complementary S‐pyridinesulfenyl activation, disulfide bonds are formed rapidly in situ. The preparation Fmoc‐Cys(oNv)‐OH is described together its for solid‐phase complex...
Abstract Despite recent advances in the treatment of diabetes mellitus, storage insulin formulations at 4 °C is still necessary to minimize chemical degradation. This problematic tropical regions where reliable refrigeration not ubiquitous. Some degradation byproducts are caused by disulfide shuffling cystine that leads covalently bonded oligomers. Consequently we examined utility non‐reducible isostere, cystathionine, within A‐chain. Reported herein an efficient method for forming this...
Relaxin is a peptide hormone produced by the corpora lutea of ovaries during pregnancy, softening and lengthening ligaments pelvis cervix in order to make childbirth easier. In attempts determine nucleotide sequence coding for relaxin, recombinant DNA techniques were used obtain cDNA clone bank from total mRNA isolated pigs late pregnancy. Clones screened using initiated synthetic oligonucleotide primers Trp Val Glu Ile porcine relaxin B chain. The undecamer [5'-ATCTCCACCCA-3'] was found...
We describe the expression in Escherichia coli, isolation by immunological screening and complete nucleotide sequence of a cDNA clone from malaria parasite Plasmodium falciparum. The deduced amino acid contains separate blocks repetitive hexapeptide pentapeptide sequences we have confirmed that these represent epitopes reaction corresponding synthetic peptides with human antibodies. As predicted size is Mr 21,000 overall composition 30% His 29% Ala, polypeptide has been termed small...
An efficient solid-phase synthesis protocol has been developed which, together with regioselective sequential formation of the three disulfide bonds, enabled preparation specifically monolanthanide (europium)-labeled human insulin-like peptide 3 (INSL3) for study its interaction G-protein-coupled receptor, RXFP2, via time-resolved fluorometry. A commercially available chelator, diethylene triamine pentaacetic acid (DTPA), was coupled to N-terminus INSL3 A-chain on solid phase, and then a...
Apical membrane antigen 1 (AMA1) of the malaria parasite Plasmodium falciparum has been implicated in invasion host erythrocytes and is an important vaccine candidate. We have previously described a 20-residue peptide, R1, that binds to AMA1 subsequently blocks invasion. Because this peptide appears target site critical for function, it represents lead compound anti-malarial drug development. However, effectiveness inhibitor was limited subset isolates, indicating requirement broader strain...
A new sarcophagine cage amine ligand with a pendent carboxylate functional group has been synthesised; the conjugated to tumour targeting peptides ([Tyr3]-octreotate and [Lys3]-bombesin) conjugates radiolabelled copper-64.
The synthesis of new cage amine macrobicyclic ligands with pendent carboxylate functional groups designed for application in copper radiopharmaceuticals is described. Reaction [Cu((NH2)2sar)]2+ (sar = 3,6,10,13,16,19-hexaazabicyclo[6.6.6]icosane) either succinic or glutaric anhydride results selective acylation the primary atoms to give derivatives one two aliphatic separated from framework by a four- five-atom linker. CuII serves protect secondary nitrogen acylation, and can be removed free...
Tumor-targeting peptides radiolabeled with positron-emitting (68)Ga are promising candidates as new noninvasive diagnostic agents for positron emission tomography (PET). The targeting tethered to a chelator that forms stable coordination complex Ga(3+) is inert dissociation of Ga(3+)in vivo. Metal complexes macrobicyclic hexaamine "sarcophagine" (sar = 3,6,10,13,16,19-hexaazabicyclo[6.6.6]icosane) ligands exhibit remarkable stability result the encapsulating nature cage amine ligand. A...
Substantial evidence suggests that soluble oligomers of Aβ are the neurotoxic form resulting in progression Alzheimer's disease (AD). Tyrosine-10 has been identified as a pivotal residue neurotoxicity and dityrosine cross-linked dimers have proposed physiologically relevant species linked to AD. We describe synthesis characterization dityrosine-linked demonstrate that, contrast other covalently dimers, discrete, stable, aggregates. Furthermore, display increased toxicity neuronal cell-line...
The identification of specific cell surface glycoprotein receptors for Arg-Gly-Asp-containing extracellular matrix proteins such as fibronectin has focused attention on the role gangliosides in this process. Is their involvement dependent or independent protein receptors? In attachment assays with cells from a human melanoma line, titration experiments an antibody (Mel 3) specificity disialogangliosides GD2 and GD3, used together synthetic peptide containing binding sequence Arg-Gly-Asp,...
Phosphotriester solid phase methodology on a polyamide support [(1980) Nucleic Acids Research, 8, 1081-1096] has been extended for the rapid synthesis of tetradecanucleotide, d(AGTTGTTTGTAGTT), octadecanucleotide, d(GTGGGTTTGGGGCAGGTC), and heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC). Thus, oligodeoxyribonucleotides comparable in size to those obtained by solution are readily accessible using techniques. An approach purification synthetic octadecanucleotide without recourse high...
Low-intensity signal seen within areas of narrowing the ventricular system has been termed CSF flow-void sign. This decreased is related to flow and turbulence. Seven normal volunteers were examined, changes that occurred in appearance CFVS noted when data acquisition was modified by cardiac gating. Flow-void patterns internal cerebral veins basilar artery also examined. The results this study confirm systole diastole. An increase hypointensity aqueduct Sylvius foramen Magendie during time...
A gastrin binding protein (GBP) has been identified in detergent extracts of porcine gastric mucosal membranes by covalent cross-linking to 125I-[Nle15]gastrin with disuccinimidyl suberate. The apparent molecular weight the cross-linked complex (80,000) is uneffected reduction suggesting that GBP not composed disulfide-bonded subunits. Subtraction 125I-gastrin indicates 78,000. similar observed previously for receptor (74,000) on intact canine parietal cells and plasma therefrom, related...
Covalently cross-linked homodimeric Aβ peptides have been prepared by solid-phase peptide synthesis exploiting 'site–site interactions', and exhibit substantially increased oligomerisation fibrillisation properties compared with the corresponding monomers.
The mechanism of electron transfer in α-aminoisobutyric (Aib) homoligomers is defined by the extent secondary structure, rather than just chain length. Helical structures (Aib units ≥3) undergo an hopping mechanism, while shorter disordered sequences <3) superexchange mechanism.