A5015267713- Plant Pathogenic Bacteria Studies
- Mycotoxins in Agriculture and Food
- Sugarcane Cultivation and Processing
- Fungal and yeast genetics research
- Natural Products and Biological Research
- Plant-Microbe Interactions and Immunity
- Plant Pathogens and Fungal Diseases
- Plant Disease Resistance and Genetics
- Fungal Biology and Applications
- Rice Cultivation and Yield Improvement
- Cocoa and Sweet Potato Agronomy
- Animal Genetics and Reproduction
- Nicotinic Acetylcholine Receptors Study
- Biofuel production and bioconversion
- CRISPR and Genetic Engineering
- Memory and Neural Mechanisms
- Neuroscience and Neuropharmacology Research
- Legume Nitrogen Fixing Symbiosis
- Microbial Natural Products and Biosynthesis
- Plant and Fungal Interactions Research
- Genetically Modified Organisms Research
- Plant pathogens and resistance mechanisms
Nantong University
2024
Southern Regional Research Center
1998-2017
Agricultural Research Service
1997
ABSTRACT The global regulatory veA gene governs development and secondary metabolism in numerous fungal species, including Aspergillus flavus . This is especially relevant since A. infects crops of agricultural importance worldwide, contaminating them with potent mycotoxins. most well-known are aflatoxins, which cytotoxic carcinogenic polyketide compounds. production aflatoxins the expression genes implicated these mycotoxins dependent. responsible for synthesis clustered, a signature common...
A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from intergenic transcribed spacer (ITS) region 16S-23S ribosomal DNA C. and cynodontis were cloned sequenced. Based on a multiple sequence alignment among these two sequences other nonredundant highly homologous database, xyli-specific primers designed, Cxx1 (5′ CCGAAGTGAGCAGATTGACC) Cxx2...
New primers were developed that greatly improved the specificity of polymerase chain reaction (PCR) protocol for Xanthomonas albilineans, causal agent sugarcane leaf scald disease. Length-polymorphic PCR products, amplified under current from 16S-23S ribosomal DNA intergenic transcribed spacers (ITS) X. albilineans and three unidentified saprophytic bacterial species, cloned sequenced. Fourteen other nonredundant ITS sequences retrieved database highly homologous to sequence albilineans. Two...
Maize ( Zea mays L.) is one of the major crops susceptible to Aspergillus flavus Link ex. Fries infection and subsequent aflatoxin contamination. Previous studies found production an antifungal 14 kDa trypsin inhibitor (TI) was associated with maize resistance. To further investigate whether TI plays any direct role in resistance, a gene silencing vector constructed transformed into maize. Mature kernels were produced from 66 transgenic lines representing 18 independent events. A final total...
Abstract Identification of sugarcane hybrids is difficult when selections are based solely on morphological traits. Our objective was to combine traits and molecular marker analysis select F 1 from two separate crosses between Djatiroto, a clone Saccharum spontaneum , elite clones, LCP 85-384 (Cross 97-3144) CP 62-258 97-3146). The maternal inflorescences Djatiroto were emasculated by submersion in circulating 45°C hot-water tank for 10 min minimize self-fertilization. Cross 97-3144 produced...
One strategy to reduce aflatoxin contamination of maize and cottonseed is introduce spores non-aflatoxigenic strains as competitors. Using isogenic mutants we show that, upon 5 or 20 min exposure 302 nm (UVB) light, the viability conidia Aspergillus flavus parasiticus lacking ability accumulate any precursor metabolite reduced five-fold compared that aflatoxin-producing pigmented precursors. This result suggests long-term introduced competitor may be lower than natural isolates when exposed sunlight.
Screening of gene manipulation events (transgenic, mutation/genome editing, etc.) is a cost/labor-intensive and time-consuming process in plant science research. While polymerase chain reaction (PCR) the most commonly used method for screening, still requires efficient DNA extraction subsequent confirmation. However, PCR cannot predict expression. To screen larger number transgenic plants, it would be ideal to develop quick reliable screening procedure. We have applied Liberty® leaf-painting...