A5038426121- Molecular Biology Techniques and Applications
- Epigenetics and DNA Methylation
- Genomics and Phylogenetic Studies
- Genetic and phenotypic traits in livestock
- Cancer-related molecular mechanisms research
- Plant Toxicity and Pharmacological Properties
- Genomics and Chromatin Dynamics
- Antioxidant Activity and Oxidative Stress
- Veterinary Equine Medical Research
- Neurological diseases and metabolism
- Genetics and Neurodevelopmental Disorders
- RNA and protein synthesis mechanisms
- Endoplasmic Reticulum Stress and Disease
- Genomics, phytochemicals, and oxidative stress
- Moringa oleifera research and applications
- Vitamin C and Antioxidants Research
- Urinary Tract Infections Management
- Effects and risks of endocrine disrupting chemicals
- Wnt/β-catenin signaling in development and cancer
- RNA Research and Splicing
- Identity, Memory, and Therapy
- Vector-borne infectious diseases
- Liver Disease Diagnosis and Treatment
- Animal Nutrition and Physiology
- Cardiovascular Health and Risk Factors
University of California, Davis
2019-2023
SomaLogic (United States)
2023
Morris Animal Foundation
2021-2022
University of Reading
1998
Abstract Aging, often considered a result of random cellular damage, can be accurately estimated using DNA methylation profiles, the foundation pan-tissue epigenetic clocks. Here, we demonstrate development universal pan-mammalian clocks, 11,754 arrays from our Mammalian Methylation Consortium, which encompass 59 tissue types across 185 mammalian species. These predictive models estimate age with high accuracy ( r > 0.96). Age deviations correlate human mortality risk, mouse somatotropic...
ABSTRACT Aging is often perceived as a degenerative process resulting from random accrual of cellular damage over time. Despite this, age can be accurately estimated by epigenetic clocks based on DNA methylation profiles almost any tissue the body. Since such pan-tissue have been successfully developed for several different species, we hypothesized that one build pan-mammalian measure in all mammalian species. To address generated data using 11,754 arrays, each profiling up to 36 thousand...
One of the primary aims Functional Annotation ANimal Genomes (FAANG) initiative is to characterize tissue-specific regulation within animal genomes. To this end, we used chromatin immunoprecipitation followed by sequencing (ChIP-Seq) map four histone modifications (H3K4me1, H3K4me3, H3K27ac, and H3K27me3) in eight prioritized tissues collected as part FAANG equine biobank from two thoroughbred mares. Data were generated according optimized experimental parameters developed during quality...
Following the successful creation of a biobank from two adult Thoroughbred mares, this study aimed to recapitulate sample collection in stallions as part Functional Annotation Animal Genome (FAANG) initiative. Both underwent thorough physical, lameness, neurologic, and ophthalmic (including electroretinography) examinations prior humane euthanasia. Epididymal sperm was recovered both immediately postmortem cryopreserved. Aseptically collected full thickness skin biopsies were used isolate,...
To determine period prevalences of postmortem diagnoses for spinal cord or vertebral column lesions as underlying causes ataxia (spinal ataxia) in horses.2,861 client-owned horses (316 with [ataxic group] and 2,545 without [control group]).The medical records database the University California-Davis Veterinary Medical Teaching Hospital was searched to identify necropsied between January 1, 2005, December 31, 2017. Results were compared ataxic control groups various group. Period determined...
Abstract Background Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder associated with a vitamin E deficiency within the first year of life. Vitamin consists 8 isoforms metabolized by CYP4F2 enzyme. No antemortem diagnostic test currently exists for eNAD/EDM. Hypothesis/Objectives Based on association α‐tocopherol development eNAD/EDM, we hypothesized that rate α‐tocopherol, but not γ‐tocopherol or tocotrienol...
Urinalysis (UA) is often used to screen for bacterial cystitis, regardless of sediment results, and followed up by quantitative urine culture (UC) definitive diagnosis.Determine prevalence positive UCs in dogs with inactive sediments on routine UA.A total 1049 samples collected from presented a veterinary specialty hospital between January 2018 February 2020.Retrospective study an UA follow-up UCs. Signalment, findings, proteinuria, UC results were recorded. Associations among these findings...
1 Abstract A high-quality reference genome assembly, a biobank of diverse equine tissues from the Functional Annotation Animal Genome (FAANG) initiative, and incorporation long-read sequencing technologies, have enabled efforts to build comprehensive tissue-specific transcriptome. The FAANG transcriptome reported here provides up 45% improvement in completeness across tissue types when compared either RefSeq or Ensembl transcriptomes. This also major improvements identification alternatively...
Long non-coding RNAs (lncRNAs) are untranslated regulatory transcripts longer than 200 nucleotides that can play a role in transcriptional, post-translational, and epigenetic regulation. Traditionally, RNA-sequencing (RNA-seq) libraries have been created by isolating transcriptomic RNA via poly-A+ selection. In the past 10 years, methods to perform ribosomal (rRNA) depletion of total developed as an alternative, aiming for better coverage whole RNA, both polyadenylated non-polyadenylated...
Idiopathic hypocalcemia in Thoroughbred (TB) foals causes tetany and seizures is invariably fatal. Based upon the similarity of this disease with human familial hypoparathyroidism occurrence only TB breed, we conducted a genetic investigation on two affected foals. Familial was identified, pedigree analysis suggested an autosomal recessive (AR) mode inheritance. We performed whole-genome sequencing foals, their unaffected dams four unaffected, unrelated horses. Both homozygosity mapping...
ABSTRACT Human DNA methylation profiles have been used successfully to develop highly accurate biomarkers of aging (“epigenetic clocks”). Here, we describe epigenetic clocks for horses, based on CpGs with flanking sequences that are conserved between multiple mammalian species. Methylation levels these were measured using a custom-designed Infinium array (HorvathMammalMethylChip40). We generated 336 from 42 different horse tissues and body parts, which five horses: multi-tissue clock, blood...
Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs neurological deficits develop within the first year life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with phenotype (p = 2.05 × 10-7 4.72 10-6). Within this...
Vitamin E deficiencies can impact normal growth and development in humans animals, assessment of circulating levels vitamin its metabolites may be an important endpoint for evaluation. Development a sensitive method to detect quantify low concentrations biological specimens allows proper diagnosis patients animals that are deficient. We developed simultaneously extract, detect, the compounds alpha-tocopherol (α-TP), gamma-tocopherol (γ-TP), alpha-tocotrienol (α-TT), gamma-tocotrienol (γ-TT),...
Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires electroencephalogram (EEG) performed a veterinary specialist. A recent study has suggested that 19 base-pair deletion, along with triple-C insertion, intron five twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa...
Equine neuroaxonal dystrophy/degenerative myeloencephalopathy (eNAD/EDM) is a hereditary, deteriorating central nervous disease in horses. Currently, the only way to confirm eNAD/EDM through postmortem histological evaluation of system. Vitamin E, specifically isoform alpha-tocopherol (α-TP), known protect susceptible horses from developing clinical phenotype. While vitamin E an essential nutrient diet horses, there are no diagnostic tests able quantitate and its metabolites urine. An...
Endoparasitism is a common disease in dogs throughout their lifetime despite the widespread availability of inexpensive diagnostic tests and effective treatments. The consequences host parasite interactions otherwise apparently healthy remains largely unknown. This cross-sectional study used complete blood count, serum biochemistry, fecal flotation data collected from 3,018 young (<3 years age) enrolled within Morris Animal Foundation Golden Retriever Lifetime Study (GRLS) to determine...
Abstract Cardiovascular disease (CVD) is the most common non-cancer cause of death in cancer survivors and there an unmet clinical need for easy, accurate, safe CVD prognostic risk-stratification adult survivors. This study investigated whether a previously validated 27-plasma protein model four-year cardiovascular (CV) events could have such utility. We used to predict risk CV event (myocardial infarction, stroke, transient ischemic attack, heart failure hospitalization, death) 906...
Background: Nonalcoholic steatohepatitis (NASH) is associated with increased cardiovascular outcomes. Assessment of the impact NASH therapy on risk an important element drug development but challenging particularly in early phase trials. Aptamer-based proteomic profiles (Somalogic®) serum have been used to develop and validate a score as surrogate for (CV) risk. Hypothesis: Improvement histology will result improved scores. Methods: A post-hoc analysis samples, using Somalogic® platform,...
Abstract The genomic sequence of the horse has been available since 2009, providing critical resources for discovering important variants regarding both animal health and population structures. However, to fully understand functional implications these variants, detailed annotation genome is required. Currently, annotated using limited RNA-seq data, as well through comparative genomics by translating human mouse annotation. While this approach served equine researchers led various...