A5066694645- Advanced biosensing and bioanalysis techniques
- DNA and Nucleic Acid Chemistry
- RNA Interference and Gene Delivery
- Calcium signaling and nucleotide metabolism
- Marine Sponges and Natural Products
- Adenosine and Purinergic Signaling
- Crystallization and Solubility Studies
- Silicon Nanostructures and Photoluminescence
- X-ray Diffraction in Crystallography
- Traditional and Medicinal Uses of Annonaceae
- Metal complexes synthesis and properties
- Microbial Natural Products and Biosynthesis
- Synthetic Organic Chemistry Methods
- Molecular Junctions and Nanostructures
- Click Chemistry and Applications
- Chemical Synthesis and Analysis
- Nanowire Synthesis and Applications
- Ferrocene Chemistry and Applications
- Ion Channels and Receptors
- Cytomegalovirus and herpesvirus research
- Supramolecular Self-Assembly in Materials
- Catalytic C–H Functionalization Methods
- Natural product bioactivities and synthesis
- Analytical Chemistry and Sensors
- Carbohydrate Chemistry and Synthesis
University of Naples Federico II
2016-2025
University of Groningen
2023
Institute of Applied Science and Intelligent Systems
2022
Naples Anesthesia & Physician Associates
2016-2020
University of Milano-Bicocca
2017-2019
Istituto Nazionale di Fisica Nucleare, Sezione di Napoli
2017-2018
Institute for Microelectronics and Microsystems
2008-2010
University of Molise
2002-2006
University of Milan
2006
University of Perugia
2006
Peptide nucleic acid (PNA) is a DNA mimic that shows good stability against nucleases and proteases, forming strongly recognized complementary strands of RNA. However, due to its feeble ability cross the cellular membrane, PNA activity targeting gene action limited. Halloysite nanotubes (HNTs) are natural low-cost aluminosilicate clay. Because peculiar membrane represents valuable candidate for delivering genetic materials into cells. Herein, two differently charged 12-mer PNAs capable...
Thrombin overexpression in serum serves as a critical biomarker and is implicated several diseases associated with significant morbidity mortality. Existing techniques for thrombin detection are time-consuming require sophisticated equipment extensive sample preparation procedures, which further delay the increase cost of procedure. Early accessible diagnosis at point care, especially limited-resource countries, represents first step clinical interventions. To overcome these limitations, we...
Laurus nobilis L. leaves are widely used in cooking and folk medicine. Five new megastigmane glucosides (2−4, 7, 9) named laurosides A−E a phenolic glucoside 12 were isolated from the methanolic extract of leaves, along with 10 known components: (5), (1, 6, 8, 10, 11), aromatic compounds (13 14), flavonoids (15 16). The structures relative stereochemistry have been elucidated by one- two-dimensional nuclear magnetic resonance experiments (1H 13C NMR, DEPT, correlation spectroscopy,...
Direct solid phase synthesis of peptides and oligonucleotides (ONs) requires high chemical stability the support material. In this work, we have investigated passivation ability porous oxidized silicon multilayered structures by two aminosilane compounds, 3-aminopropyltriethoxysilane 3-aminopropyldimethylethoxysilane (APDMES), for optical label-free ON biosensor fabrication. We also studied spectroscopic reflectometry hybridization between a 13 bases ON, directly grown on modified in situ...
In recent years considerable attention has been given to the use of natural substances as anticancer drugs. The antioxidant dipeptide L-carnosine belongs this class molecules because it proved have a significant activity both in vitro and vivo. Previous studies shown that inhibits proliferation human colorectal carcinoma cells by affecting ATP Reactive Oxygen Species (ROS) production. present study we identified Hypoxia-Inducible Factor 1α (HIF-1α) possible target HCT-116 cell line. HIF-1α...
Aptamer selection against novel infections is a complicated and time-consuming approach. Synergy can be achieved by using computational methods together with experimental procedures. This study aims to develop reliable methodology for rational aptamer in silico et vitro design. The new approach combines multiple steps: (1) Molecular design, based on screening DNA library directed mutagenesis fit the protein tertiary structure; (2) 3D molecular modeling of target; (3) docking an protein; (4)...
Four new acyclic diterpene glycosides named capsianosides (1−4), together with 12 known compounds, were isolated from the fresh sweet pepper fruits of Capsicum annuum L., a plant used as vegetable food, spice, and external medicine. The chemical structures natural well their absolute configurations, established by means spectroscopic data including infrared, high-resolution mass spectrometry, one- two-dimensional nuclear magnetic resonance derivatization. capsidiol (11) showed bacteriostatic...
In this work, we establish the use of surface-enhanced Raman scattering (SERS) as a label-free analytical technique for direct detection G-quadruplex formation. particular, demonstrate that SERS analysis allows evaluation relative stability G quadruplexes differ number tetrads and investigate several structural features quadruplexes, such orientation glycosidic bonds, identification distortions in sugar-phosphate backbone, degree hydrogen-bond solvation. Herein, fluctuation spectra, due to...
Computational techniques, and in particular molecular dynamics (MD) simulations, have been successfully used as a complementary technique to predict analyse the structural behaviour of nucleic acids, including peptide acid- (PNA-) RNA hybrids. This study shows that 7-base long PNA seed region miR-509-3p, one miRNAs involved posttranscriptional regulation CFTR disease-gene Cystic Fibrosis, bearing suitable functionalization at its N- C-ends aimed improving resistance nucleases cellular...
Many antiproliferative G-quadruplexes (G4s) arise from the folding of GT-rich strands. Among these, Thrombin Binding Aptamer (TBA), as a rare example, adopts monomolecular well-defined G4 structure. Nevertheless, potential anticancer properties TBA are severely hampered by its anticoagulant action and, consequently, no related studies have appeared so far in literature. We wish to report here that suitable chemical modifications sequence can preserve over activity. Particularly, we replaced...
Human α-thrombin (TB) is a serine protease with crucial role in coagulation and hemostasis.
The cKit87up sequence d(5′AGGGAGGGCGCTGGGAGGAGGG3′) can form a unique G-quadruplex structure in the promoter region of human c-kit protooncogene. It provides peculiar platform for design selective quadruplex-binding agents, which could potentially repress protooncogene transcription. In this study, we examined binding small library PNA probes (P1−P5) targeting quadruplex either K+- or NH4+-containing solutions by using combination UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results...
An acyclic pyrimidine analogue, containing a five-member cycle fused on the ring, was synthesized and introduced at position 7 or 12 of 15-mer oligodeoxynucleotide GGTTGGTGTGGTTGG, known as thrombin-binding aptamer (TBA). Characterization by 1H NMR CD spectroscopies resulting aptamers, TBA-T7b TBA-T12b, showed their ability to fold into typical antiparallel chairlike G-quadruplex structure formed TBA. The apparent melting temperatures indicated that introduction residue, mainly 7, improves...
Among non-canonical DNA secondary structures, G-quadruplexes are currently widely studied because of their probable involvement in many pivotal biological roles, and for potential use nanotechnology. The overall quadruplex scaffold can exhibit several morphologies through intramolecular or intermolecular organization G-rich oligodeoxyribonucleic acid strands. In particular, strands form higher order assemblies by multimerization between G-quadruplex units. Here, we report on the...
Cystic Fibrosis (CF) is one of the most common life shortening conditions in Caucasians. CF caused by mutations Transmembrane Conductance Regulator (CFTR) gene which result reduced or altered CFTR functionality. Several microRNAs (miRNAs) downregulate expression CFTR, thus causing exacerbating symptoms CF. In this context, design anti-miRNA agents represents a valid functional tool, but its translation to clinic might lead unpredictable side effects because interference with other genes...
The B-cell lymphoma 2 (Bcl-2) gene encodes for an antiapoptotic protein associated with the onset of many human tumors. Several oligonucleotides (ONs) and ON analogues are under study as potential tools to counteract Bcl-2 expression. Among these Peptide Nucleic Acids (PNAs). absence charges on PNA backbones allows formation PNA/DNA complexes provided higher stability than corresponding natural DNA/DNA counterparts. To date, use PNAs in antigene or antisense strategies is strongly limited by...
ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as food preservative. ε-PLL its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in biomedical field enhancers drugs for drug gene delivery applications. Recently, several studies reported interaction between these non-canonical peptides DNA targets. Among most important targets secondary structures known G-quadruplexes (G4s)...
The oral route is highly desirable for colorectal cancer (CRC) treatment because it allows concentrating the drug in colon and achieving a localized effect. However, orally administered drugs are often metabolized liver, resulting reduced efficacy need higher doses. Nanoparticle-based delivery systems can be engineered to prevent diffusion of stomach, addressing release at target site, enhancing delivered drug. Here, an administrable galunisertib system developed with gelatin-covered...
Abstract Redox‐responsive silica drug delivery systems are synthesized by aeco‐friendly diatomite source to achieve on‐demand release of peptide nucleic acid (PNA) in tumor reducing microenvironment, aiming inhibit the immune checkpoint programmed cell death 1 receptor/programmed receptor ligand (PD‐1/PD‐L1) cancer cells. The nanoparticles (NPs) coated with polyethylene glycol chains as gatekeepers improve their physicochemical properties and control through cleavable disulfide bonds (S–S) a...