- DNA and Nucleic Acid Chemistry
- Metal complexes synthesis and properties
- Advanced biosensing and bioanalysis techniques
- Medical Imaging Techniques and Applications
- Radiopharmaceutical Chemistry and Applications
- Lanthanide and Transition Metal Complexes
- RNA and protein synthesis mechanisms
- Cancer-related Molecular Pathways
- Ferrocene Chemistry and Applications
- RNA Interference and Gene Delivery
- Magnetism in coordination complexes
- Analytical Chemistry and Chromatography
- Crystallization and Solubility Studies
- Metal-Catalyzed Oxygenation Mechanisms
- X-ray Diffraction in Crystallography
- Genomic variations and chromosomal abnormalities
- Molecular Junctions and Nanostructures
- Organometallic Complex Synthesis and Catalysis
- Cancer Genomics and Diagnostics
- Click Chemistry and Applications
- Organometallic Compounds Synthesis and Characterization
- Thermal and Kinetic Analysis
- Crystal structures of chemical compounds
- Color Science and Applications
- Biological Stains and Phytochemicals
University of Reading
2013-2023
Reading Museum
2015-2020
Diamond Light Source
2013-2019
Didcot Community Hospital
2019
Haukeland University Hospital
2016
University of Bergen
2016
Instituto de Química Física Blas Cabrera
2016
Research Complex at Harwell
2016
Rutherford Appleton Laboratory
2016
European Molecular Biology Laboratory
2016
We describe a crystal structure, at atomic resolution (1.1 Å, 100 K), of ruthenium polypyridyl complex bound to duplex DNA, in which one ligand acts as wedge the minor groove, resulting 51° kinking double helix. The cation Λ-[Ru(1,4,5,8-tetraazaphenanthrene) 2 (dipyridophenazine)] 2+ crystallizes 1∶1 ratio with oligonucleotide d(TCGGCGCCGA) presence barium ions. Each binds by intercalation dipyridophenazine and also semiintercalation orthogonal tetraazaphenanthrene ligands into second...
I-motif stability is enhanced by short loop lengths compared to long lengths.
We report an atomic resolution X-ray crystal structure containing both enantiomers of rac-[Ru(phen)2dppz]2+ with the d(ATGCAT)2 DNA duplex (phen = phenanthroline; dppz dipyridophenazine). The first example any enantiomeric pair crystallized a shows different orientations Λ and Δ binding sites, separated by clearly defined structured water monolayer. Job plots show that same species is present in solution. Each enantiomer bound at TG/CA step intercalation from minor groove. One molecule...
The DNA G-quadruplex is known for forming a range of topologies and the observed lability assembly, consistent with its transient formation in live cells. stabilization particular topology by small molecule great importance therapeutic applications. Here, we show that ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific binding. It crystallized 1:1 stoichiometry modified human telomeric sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), an antiparallel chair topology, first...
Abstract Oligonucleotides that target mRNA have great promise as therapeutic agents for life-threatening conditions but suffer from poor bioavailability, hence high cost. As currently untreatable diseases come within the reach of oligonucleotide therapies, new analogues are urgently needed to address this. With this in mind we describe reduced-charge oligonucleotides containing artificial LNA-amide linkages with improved gymnotic cell uptake, RNA affinity, stability and potency. To construct...
Lack of selectivity is one the main issues with currently used chemotherapies, causing damage not only to altered cells but also healthy cells. Over last decades, photodynamic therapy (PDT) has increased as a promising therapeutic tool due its potential treat diseases like cancer or bacterial infections high spatiotemporal control. Ruthenium(II) polypyridyl compounds are gaining attention for their application photosensitizers (PSs) since they generally nontoxic in dark conditions, while...
Objectives. To investigate the expression and function of triggering receptor expressed on myeloid cells-1 (TREM-1) in synovium human RA patients as well level soluble TREM-1 plasma patients. Methods. Twenty-four synovial samples were analysed by gene oligonucleotide microarrays. Expression levels mRNA murine CIA paws determined quantitative PCR (qPCR). protein was detected immunohistochemistry five two OA samples. TREM-1-positive cells from tissues FACS staining to determine cell type....
Strikingly different TRIR spectra are recorded for the complex in D<sub>2</sub>O or CD<sub>3</sub>CN when DNA-bound.
Abstract By using X‐ray crystallography, we show that the complexes Λ/Δ‐[Ru(TAP) 2 (11‐CN‐dppz)] 2+ (TAP=1,4,5,8‐tetraazaphenanthrene, dppz=dipyridophenazine) bind DNA G‐quadruplex in an enantiospecific manner parallels specificity of these with duplex DNA. The Λ complex crystallises normally parallel stranded d(TAGGGTTA) tetraplex to give first such antiparallel strand assembly which syn ‐guanosine is adjacent at 5′ end quadruplex core. SRCD measurements confirm same conformational switch...
[Ru(phen)2(dppz)]2+ has been studied since the 1990s due to its 'light-switch' properties. It can be used as a luminescent DNA probe, with emission switched on through binding. The luminescence observed is dependent solvent accessibility of pyrazine nitrogen atoms, and therefore sensitive changes in both binding site cation chromophore orientation. compound also chiral, there are distinct differences between enantiomers terms behaviour when bound variety sequences. Whilst number binary...
Small changes in DNA sequence can often have major biological effects. Here the rates and yields of guanine photo-oxidation by Λ-[Ru(TAP)2(dppz)](2+) been compared 5'-{CCGGATCCGG}2 5'-{CCGGTACCGG}2 using pico/nanosecond transient visible time-resolved IR (TRIR) spectroscopy. The inefficiency electron transfer TA is consistent with 5'-TA-3' versus 5'-AT-3' binding preference predicted X-ray crystallography. TRIR spectra also reveal differences sites two oligonucleotides.
Polypyridyl ruthenium complexes have been intensively studied and possess photophysical properties that are both interesting useful. They can act as probes for DNA, with a substantial enhancement in emission when bound, induce DNA damage upon photoirradiation. Therefore, the synthesis characterization of binding new is an area intense research activity. While knowledge how derivatives compares to parent compound highly desirable, this information be difficult obtain. Here we report three...
Hydration-dependent DNA deformation has been known since Rosalind Franklin recognized that the relative humidity of sample had to be maintained observe a single conformation in fiber diffraction. We now report for first time crystal structure, at atomic level, dehydrated form duplex and demonstrate reversible interconversion hydrated room temperature. This system, containing d(TCGGCGCCGA) presence Λ-[Ru(TAP)2(dppz)](2+) (TAP = 1,4,5,8-tetraazaphenanthrene, dppz...
Λ-[Ru(TAP)2(dppz)]2+ was crystallised with the G-quadruplex-forming heptamer d(TAGGGTT). Surprisingly, even though there are four unique binding sites, complex is not in contact any G-quartet surface. Two complexes stabilise cavities formed from terminal T·A and T·T mismatched pairs. A third shows kinking by a TAP ligand between linkages, while fourth sandwiching of dppz T·A/T·A quadruplex mismatch, stabilised an additional base pair stacking interaction on Overall, structure unexpected...
Abstract X‐ray crystal structures of three Λ‐[Ru(L) 2 dppz] 2+ complexes (dppz=dipyridophenazine; L=1,10‐phenanthroline (phen), 2,2′‐bipyridine (bpy)) bound to d((5BrC)GGC/GCCG) showed the compounds intercalated at a 5′‐CG‐3′ step. The bind through canted intercalation, with binding angle determined by guanine NH group, in contrast symmetrical intercalation previously observed 5′‐TA‐3′ sites. This result suggests that is preferred sites even though site itself symmetrical, and we hypothesise...
Abstract Key to the development of DNA‐targeting phototherapeutic drugs is determining interplay between photoactivity drug and its binding preference for a target sequence. For photo‐oxidising lambda‐[Ru(TAP) 2 (dppz)] 2+ (Λ‐1) (dppz=dipyridophenazine) complex bound either d{T 1 C G 3 4 5 6 7 8 9 A 10 } ( G9 ) or d{TCGGCGCCIA} I9 ), X‐ray crystal structures show dppz intercalated at terminal T ;G step ;I step. Thus substitution nucleobase by inosine does not affect intercalation in solid...
The new complexes [Ru(TAP)2 (11-CN-dppz)]2+ , (11-Br-dppz)]2+ and (11,12-diCN-dppz)]2+ are reported. addition of nitrile substituents to the dppz ligand DNA photo-oxidising complex (dppz)]2+ promote π-stacking interactions ordered binding DNA, as shown by X-ray crystallography. structure Λ-[Ru(TAP)2 with duplex d(TCGGCGCCGA)2 shows, for first time this class complex, a closed intercalation cavity an AT base pair at terminus. obtained is compared that formed 11-Br 11,12-dinitrile derivatives,...
Oligodeoxynucleotides incorporating internucleotide phosphoroselenolate linkages have been prepared under solid-phase synthesis conditions using dimer phosphoramidites. These dimers were constructed following the high yielding Michaelis-Arbuzov (M-A) reaction of nucleoside H-phosphonate derivatives with 5'-deoxythymidine-5'-selenocyanate and subsequent phosphitylation. Efficient coupling phosphoramidites to solid-supported substrates was observed both manual automated required only minor...
A spectroscopic study of the interactions Λ- and Δ-[Ru(phen)2(dppz)]2+ with i-motif DNA containing thymine loops various lengths. In presence i-motifs, luminescence Λ enantiomer was enhanced much more than Δ. Despite this, effect each on thermal stability comparable. The sequences most affected by [Ru(phen)2(dppz)]2+ were those long loops; this suggests that long-looped i-motifs are attractive targets for potential transition metal complex drugs should be explored further in drug design.
The crystal structure of the ruthenium DNA 'light-switch' complex Λ-[Ru(TAP)2(11-Cl-dppz)](2+) (TAP=tetraazaphenanthrene, dppz=dipyrido[3,2-a':2',3'-c]phenazine) bound to oligonucleotide duplex d(TCGGCGCCGA)2 is reported. synthesis racemic described for first time, and racemate was used in this study. structure, at atomic resolution (1.0 Å), shows one ligand as a wedge minor groove, resulting 51(°) kinking double helix, with parent Λ-[Ru(TAP)2(dppz)](2+). Each binds by intercalation dppz...