A5083176662- RNA Interference and Gene Delivery
- Dendrimers and Hyperbranched Polymers
- Advanced biosensing and bioanalysis techniques
- DNA and Nucleic Acid Chemistry
- Gold and Silver Nanoparticles Synthesis and Applications
- Nanoparticle-Based Drug Delivery
- Immunotherapy and Immune Responses
- MicroRNA in disease regulation
- Advanced Nanomaterials in Catalysis
- Graphene and Nanomaterials Applications
- vaccines and immunoinformatics approaches
- Click Chemistry and Applications
- Sulfur Compounds in Biology
- Ferrocene Chemistry and Applications
- Polyoxometalates: Synthesis and Applications
- Luminescence and Fluorescent Materials
- Virus-based gene therapy research
- Inflammasome and immune disorders
- Protein Structure and Dynamics
- Nanoplatforms for cancer theranostics
- Protein Interaction Studies and Fluorescence Analysis
- Spectroscopy Techniques in Biomedical and Chemical Research
- Polymer Surface Interaction Studies
- Nanoparticles: synthesis and applications
- Antimicrobial agents and applications
University of Łódź
2015-2024
University of Urbino
2010
Laboratoire de Chimie de Coordination
2010
Centre National de la Recherche Scientifique
2010
Hospital General Universitario Gregorio Marañón
2007
Universidad de Alcalá
2007
Original metallophosphorus dendrimers (generation 3, 48 terminal groups) have been prepared via the complexation of phosphorus bearing imino-pyridino end groups with Au(III) or both and Cu(II). The dendrimer Au(III), leading to 1G3-[Au48][AuCl4]48, strongly increased antiproliferative activities against KB HL-60 tumoral cell lines, showing IC50s in low nanomolar range. It can be noticed also that this gold conjugated displayed activity on quiescent line EPC versus its potent actively...
The disruption of the cellular pathways protein biosynthesis through mechanism RNA interference has been recognized as a tool great diagnostic and therapeutic significance. However, in order to fully exploit potential this phenomenon, efficient safe carriers capable overcoming extra- intracellular barriers delivering siRNA target cells are needed. Recently, attention focused on possibility application multifunctional nanoparticles, dendrimers, delivery devices for siRNA. aim present work was...
Gene therapy presents an innovative approach to the treatment of previously incurable diseases. The advancement research in field nanotechnology has potential overcome current limitations and challenges conventional methods, therefore unlocking full dendrimers for use gene neurodegenerative disorders. blood-brain barrier (BBB) poses a significant challenge when delivering therapeutic agents central nervous system. In this study, we investigated biophysical properties their complexes with...
Research concerning new targeting delivery systems for pharmacologically active molecules and genetic material is of great importance. The aim the present study was to investigate potential fourth generation (P4) cationic phosphorus-containing dendrimers bind fluorescent probe 8-anilino-1-naphthalenesulfonate (ANS), anti-neoplastic drug cisplatin, anti-HIV siRNA siP24 its capability deliver green protein gene (pGFP) into cells. interaction between P4 ANS (as model drug) investigated. binding...
Drug delivery systems such as dendrimers, liposomes, polymers or gold/silver nanoparticles could be used to advance modern medicine. One significant pharmacological problem is crossing biological barriers by commonly drugs, e.g., in the treatment of neurodegenerative diseases, which have a blood-brain barrier (BBB) restricting drug delivery. Numerous studies been conducted find appropriate carriers that are safe, biocompatible and efficient. In this work, we evaluate pegylated gold AuNP14a...
Treatment of dendriplexes formed between water-soluble carbosilane dendrimers and phosphorothioate oligodeoxynucleotides (ODN) with the anionic detergentsodium dodecyl sulfate disrupted complexes indicating that nature union in such is merely electrostatic. However, were not dissociated by serum proteins like bovine or human albumins, as assessed gel electrophoresis fluorescence experiments. This would imply a dendrimer-mediated protective effect able to prevent ODN interactions additionally...
Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) a class of antisense therapy drugs cancer and infectious or metabolic diseases. The interactions between short (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled fluorescein-labeled), novel water-soluble carbosilane dendrimers, bovine serum albumin were studied by fluorescence gel electrophoresis. molar ratios the dendrimer/ODN dendriplexes ranged from 4 to 7....
There are many types of dendrimers used as nanomolecules for gene delivery but there is still an ongoing search ones that able to effectively deliver drugs cells. The possibility silencing using siRNA gives hope effective treatment numerous diseases. aim this work was investigate in vitro biophysical properties dendriplexes formed by and cationic phosphorus 3rd 4th generation. First, the ethidium bromide intercalation method, it examined whether have ability form complexes with siRNA. Next,...
The fact that cancer is one of the leading causes death requires researchers to create new systems effective treatment for malignant tumors. One promising area genetic therapy uses small interfering RNA (siRNA). These molecules are capable blocking mutant proteins in cells, but require specific will deliver target cells and successfully release them into cytoplasm. Dendronized PEGylated silver nanoparticles as potential vectors proapoptotic siRNA (siMCL-1) were used here. Using methods...
The success of gene therapy depends on the development suitable carriers, and because their architecture dendrimers are promising tools for delivery. This research concerns use second generation carbosilane as carriers anti-HIV oligodeoxynucleotides (ODNs). aim was to characterize complexes formed by positively charged negatively oligonucleotides using a fluorescence method, laser Doppler electrophoresis, dynamic light scattering (DLS), atomic force microscopy (AFM), transmission electron...
Gold nanoparticles (AuNPs) and polycationic macromolecules are used as gene carriers. Their behaviour is dependent on several factors, such the size type of framework, charge, etc. We have combined both types systems prepared AuNPs covered with cationic carbosilane dendrons aim to evaluate their biocompatibility. Water soluble dendronized were following a straightforward procedure from dendrons, gold precursor reducing agent in water characterized by 1H NMR, transmission electron microscopy...
A key pathological event of prion and Alzheimer diseases is the formation amyloid plaques generated by peptide aggregation in form fibrils. Dendrimers have revealed their ability to prevent fibril therefore cure neurodegenerative diseases. To provide information about kinetics mechanism dendrimers aggregation, we performed a computer-aided EPR analysis selected nitroxide spin probe 4-octyl-dimethylammonium,2,2,6,6-tetramethyl-piperidine-1-oxyl bromide (CAT8) water solutions β-amyloid Aβ 1-28...
Gene therapy is a promising approach in cancer treatment; however, current methods have number of limitations mainly due to the difficulty delivering therapeutic nucleic acids their sites action. The application non-viral carriers based on nanomaterials aims at protecting genetic material from degradation and enabling its effective intracellular transport. We proposed use silver nanoparticles (AgNPs) surface-modified with carbosilane dendrons as anticancer siRNA (siBcl-xl). Using gel...
Hybrid carbosilane–viologen–phosphorus dendrimers were prepared, as an example of the synthetic “onion peel” approach, on search new physical–chemical and biological properties, respecting traditional dendritic architectures.